To the evolution deniers

[DogmaHunter]

Mankind is either progressing or not.

Define "progressing" in context of evolution.
Does it mean "stronger, bigger, faster, smarter"?

Or does it rather mean "better adapted to the environment"?
In the sense that "better adapted" could also mean: smaller, slower, dumber?

On ignornace?
Perhaps you omit Divine Providence. Ignoring such seems to be the issue with materialists.

I'm not omitting anything that can be shown to actually play a role and even exist.

 

[Almost there]

I didn't see anywhere in the linked article where it claimed that all mutations are negative.

It doesn't. Nor do I. I believe they all probably are. I believe it is all devolving, not evolving. It doesn't get better. It gets worse.

I believe ancient man, out of the womb, was superior to modern man.

 

[Almost there]

And it is. Very easily. It is tested all the time. Every new genome sequenced, every fossil found, every body (or part thereof) that gets its anatomy analysed,... Every single one of them is a test for the model.

And the model keeps changing.

When I think of evolution theory and all the changes that must be made as new discoveries are made, I'm reminded of Ptolomy.

Something else I think about when people mention evolution theory is my old 2001 Chrysler 300m. Imagine some race of beings coming to our planet a couple of million years from now, long after mankind is extinct or has left the planet a Mars-like hulk. They find my car perfectly preserved in ice or many layers of rock, etc.

Now, imagine they find a 2001 Dodge Neon from the same year, but catastrophies have placed it in a layer of rock they determine to be a million years older. As they look at the makeup of both cars, they notice that they share the same, exact door handle (they do). When analyzing the qualities of the cars and the suggested age of each, they deduce that the 300m evolved from the Neon. And to further complicate things, they later find a 2001 dodge intrepid and announce they have found the missing link!

Except what really happened was this:

1. Both cars were designed for human occupants.
2. Both cars were designed to be effectively useful for humans to transport humans and some of their stuff.
3. Both were designed for the same road conditions and environment.
4. Both were designed by the same company with the same general goals.
5. The company believed in efficiency of production and economy, and saw no reason to design two separate door handles when one design and manufacturing process was sufficient.

i.e. the similarites between species do not prove evolution. They prove design.

"They're trying to find themselves an audience. Their deductions need applause." --- Peter Gabriel (The Lamb Lies Down on Broadway - Genesis)

 

[BradB]

Just to expand on this further, what does "information" mean in this context?

Information in this context would be code sequences found in the DNA molecule in which the arrangements of the nucleotides produce a certain trait in the organism.

New information would be in the form of a completely new arrangement of the nucleotides in a way that did not previously exist in any of the population which produce some new or visibly changed trait.

Beneficial information is an arrangement of the nucleotides into a code which produces a trait which aids rather than hinders the organisms survival.

Observed in this context means under a controlled environment in which someone observed the change happen where it is known that the trait did not exist in any of the population prior to the observation. It does not mean lizards were brought to an island and abandoned and when revisited 20 years later they were seen to have some trait that they were thought not to have prior.

Add all four and you have the type of mutation which would be required to show universal common descent aka molecules to man evolution were at least feasible. That is to say you would have to observe new and beneficial information being added to the genome (of a multi-celled organism) population through a completely random mutation.

 

[BradB]

which single-celled organisms are you talking about?

The unmarried kind that are not seeing anyone in particular.

 

[tas8831]

It isn't. Here are several biologists who reject the theory of evolution:

• Fazale Rana
• David Berlinski
• Michael Behe
• Paul Chien
• Michael Denton
• Nathaniel Jeanson
• David Menton
• etc.

Berlinski is not a biologist - not even close.

Menton has a documented history of, no nice way to put it, lying about evolution (that or he is amazingly incompetent).

Denton had to basically retract much of his 1996 book, and actual evolutionary biologists continue to document his many errors.

Lists like these are often not the friend of the creationist.

 

[tas8831]

Information in this context would be code sequences found in the DNA molecule in which the arrangements of the nucleotides produce a certain trait in the organism.

New information would be in the form of a completely new arrangement of the nucleotides in a way that did not previously exist in any of the population which produce some new or visibly changed trait.

So, would this count as "completely new arrangement"?

original:

ATGGTCAGTCGTTTAAGGCTAT

'new':


ATGGTCAGTCGTTTACGGCTAT

 

[Almost there]

Menton has a documented history of, no nice way to put it, lying about evolution (that or he is amazingly incompetent).

Reminds me of piltdown man.

 

[BradB]

Yet paleontologists don't consider that a problem for the evolutionary model, so why do you?

Very good question. Will you bare with me for the answer? It is not a problem for evolutionists because they only have one hat in the race. However in a debate between one possible origin of life being a creator, and the other being natural abiogenesis followed by universal common descent, you must toss out any evidence that is polysemic. Take this example to explain what I mean. When Robert Blake was on trial for the murder of his wife the prosecution had the evidence all over Blake. They knew they had their guy. The evidence was gun shot residue found on his hands and cloths the night of the murder. However the defense attorney raised the fact that Blake was a hand gun owner and had been at the range earlier that day target practicing. This was an "alternative" explanation for the "same evidence" which showed it did not prove he was guilty of murder. The evidence was polysemic and had to be thrown out. All evidence used by evolutionist paleontologists to support evolution is based on similarity of some sort when boiled down. But like the defense attorney, we creationists raise the point that similarity is expected between life forms had they all had a common creator. What that means is that any argument based on similarity is polysemic and useless in this debate. IT MUST BE THROWN OUT of the debate. Why do most paleontologists not have a problem with it? Because for personal reasons most dismiss the notion of a creator as a possibility before they even address the issue. Therefore they've only got one hat in the race. For them there is only on plausible explanation. Let me ask you, who wins a race "with only one competitor?" Do most of the worlds scientists agree with the current winner? Absolutely. But are you willing to take an honest look at why this is? The answer is surprisingly a spiritual answer not a scientific one. Jesus told us that wide is the path that leads to destruction and many are on that path. He said straight is the gate and narrow is the way that leads to eternal life and few are there who find it. What He was telling us is that the majority of the world will not accept spiritual truths. If one is forced to admit that there is a creator then one is forced to wrestle with his or her own spirituality. It is the same reason that a criminal cannot find a cop while he is attempting a crime. He doesn't want to find a cop and will do every thing in his power to avoid encountering one. When he does run into a cop he makes up outlandish excuses for the evidence against him. "Those are not my drugs officer...these aren't even my pants..." "There is no creator, highly specified life must have formed itself."

You mean like a series of skulls that shows, for example, how the blowhole of a whale gradually moved from the front of the face, like a regular nose, in the ancestral land animal, to the top of the head in the present day sea-dwelling mammal?

Well now that you mention it...yes. That's a perfect example. In Gould's famous article "Hooking Leviathan by its past" he does this very thing when discussing whale evolution. He presents four of five specimens, points out their similar features and "ties" them all together as what he calls a "chain" based only on similarity. But when you examine each specimen more closely you discover there are crazy jumps in size and changes in other parts of their structure that are huge changes. Again if you have not other explanation for these creatures existence besides evolution then they absolutely have to be related. But if you believe there is just even a possibility they are the product of special creation by one creator then the similar features are explained in the same way a car manufacturer makes many similar features within their different models of automobiles.

And how do the blonde genes come about, do you think?

Well if you are asking within the frame work of the analogy they already existed as an allel within the human gene-pool.

I just did and you handwaved it away.

No I asked for an example of OBSERVED, NEW, and BENEFICIAL information being added to the genome of a multi-celled organism. Who studied the monks prior to their move to the high altitudes and noted that the gene did not exist in any populations of the world prior? Anser-->NO ONE! You did not provide what I asked for. I hand waved something away that did not meat the stated requirements.

Except of course, that speciation is the result of mutation + selection.

No friend there is no evidence that speciation is anything other than bad mutations causing a loss of information that worked to the new species advantage. Beetles on a windy island sometimes reproduce with a defect that makes them unable to fly. The non fliers don't get blown out to sea while the fliers do. Thus the non fliers reproduce and make more non flying beetles. Ta da! a new species. But it didn't form because new and beneficial information that never existed in the gene-pool suddenly mutated into existence.

 

[Speedwell]

However in a debate between one possible origin of life being a creator, and the other being natural abiogenesis followed by universal common descent...

Such a debate would be based on a false dichotomy. Naturalistic abiogenesis and universal common descent does not rule out a creator god.

 

[BradB]

So, would this count as "completely new arrangement"?

I have no idea? I am not a geneticist. How about you link a scientific paper that meats the requirements I laid out and I will take a look at it.

 

[BradB]

Such a debate would be based on a false dichotomy. Naturalistic abiogenesis and universal common descent does not rule out a creator god.

Very true. But it would rule out the God of the Bible as being the Creator. Because He told us how He created life and it didn't involve abiogenesis or UCD.

 

[Ophiolite]

So we don't get at cross purposes, which single-celled organisms are you talking about? Prokaryotes exclusively, or prokaryotes and eukaryotes, and if prokaryotes, bacteria or archaea? Since plasmids are found in bacteria, archaea and eukaryotes, what is it you consider to be unique about them? (And if, as you seem to do, you acknowledge some multi-cellular organisms have them, then you seem to have a unique definition of unique.)

Brad, this was my post #90 to you. I guess you overlooked it, since you have made several subsequent posts in response to others. I would be obliged if you would reply.

Edit: I've just noticed that you had replied in post #105. I agree that this one liner was amusing, but it was not a serious answer. I presume you are here for a serious discussion. Would you please now provide a proper answer, so we may progress the discussion.

 

[PsychoSarah]

I believe ancient man, out of the womb, was superior to modern man.

-_- they had measurably smaller brains, and guess what, their differences with modern people didn't withstand the test of time, did they?

 

[PsychoSarah]

I have no idea? I am not a geneticist. How about you link a scientific paper that meats the requirements I laid out and I will take a look at it.

"Completely new arrangement" is so ambiguous that it could be anything from 1 base pair deletion to two chromosomes fusing. This is not a standardized scientific term.

 

[redleghunter]

Such a debate would be based on a false dichotomy. Naturalistic abiogenesis and universal common descent does not rule out a creator god.

Universal common descent does not rule out a creator God. We see evidence of this in Genesis chapter 5:

Bible Gateway passage: Genesis 5 - New King James Version

 

[Almost there]

-_- they had measurably smaller brains, and guess what, their differences with modern people didn't withstand the test of time, did they?

I'm referring to Adam.

And no, they didn't withstand the test of time. That's de-evolution for you.

 

[PsychoSarah]

I'm referring to Adam.

Irrelevant to mention people that left behind no evidence of their existence whatsoever. Regardless, your position is that all organisms are "getting worse". The fact that at any point in the past human brains were smaller than modern ones means that improvement has occurred within some time frame.

Also, you have to consider what improvement would actually be in terms of evolution. Consider a population of fish with functional eyes that lives so deep under water that there is not sufficient light with which to see. Over time, this fish population loses its eyes. This is an improvement, because the fish are no longer wasting resources on a structure they have no use for.

 

[Speedwell]

Very true. But it would rule out the God of the Bible as being the Creator. Because He told us how He created life and it didn't involve abiogenesis or UCD.

Right. As usual, this discussion is not about theism vs atheism. It's about a Protestant minority vs everybody else, theist and atheist alike.

 

[Almost there]

Irrelevant to mention people that left behind no evidence of their existence whatsoever. Regardless, your position is that all organisms are "getting worse". The fact that at any point in the past human brains were smaller than modern ones means that improvement has occurred within some time frame.

Also, you have to consider what improvement would actually be in terms of evolution. Consider a population of fish with functional eyes that lives so deep under water that there is not sufficient light with which to see. Over time, this fish population loses its eyes. This is an improvement, because the fish are no longer wasting resources on a structure they have no use for.

Does bigger always mean better? I think it is a major factor, but there are other's to consider. I know my four cylinder 2000 cc Boxer engine on my FR-S has a lot more horsepower than the 2800 cc six cylinder engine on my old Plymouth Duster.

And regarding those deep water fish. At least two possibilities:

1. They "lost" their eyes.
2. The were designed without eyes and found it possible to thrive in the dark water where the fish with eyes would not survive.
3.