For those wondering what "macroevolution" actually is...

[Shemjaza]

Absolutely- if you corrupt it, it no longer performs it's function. Pretty straightforward

This applies to the software running this forum, blueprints, DNA, a printed book, carvings on the Rosetta Stone

There are many grey areas in science, but this really isn't one of them

That isn't an objective method of measurement. How do you detect the corruption or function?

You seem to be shifting between undefined terms for the same thing.

Again you could ask an archeologist or forensic scientist- i.e. it is a fairly disciplined process- not merely 'intuition'- even if that might be correct. And not exclusive to biology or DNA
(but more below)

Again the archaeologist and forensic scientist works from defining mechanisms and looking for familiar patterns.

We don't have anything like that for DNA and life.

I think you point to a very good (and often confused) point about complexity.

If we dump two separate piles of 100 bricks from a loader, then we build a 10 x 10 wall from one of those piles. Which pattern is more complex?

To describe the pile, I would need to specify the x,y and z coordinates of each brick's center, and then specify the rotation about each axis- 6 data points for each brick = 600 numbers to describe the pile. Then to describe how to re-create that pile, you would need a very precise order in which the bricks must be placed or the end result would be impossible.

The wall needs only very simple instructions, place 10 end to end, repeat on top of the last layer till out of bricks.. not the most architecturally sound design but you get the point

i.e. the information problem in DNA is not about mere complexity but specificity

The wall specifies not only a pile of bricks, but something purposeful beyond that.

Just asa gambler playing 3 royal flushes in a row, the specificity of the result raises the probability of something besides 'chance' at work.

As above, a hand of cards specifying no value, can be adequately accounted for by the random shuffling of the deck.

This is a common and poor analogy for the evolution of life.

The chances of pulling 3 royal flushes in a row is trivial if you get to replace one card at a time repeatedly until you get the final result.

No single example of life is the only option for the situation it is in. Every step of the way might have given a different slightly different but successful option.


Using your wall analogy the internal structure of a diamond is perfectly regular, but stainless steel is a churned up mess of metals.

And in the wider perspective, we're talking about the chance assembly of chemistry and physics constructed according to a digital blueprint- that is able to contemplate it's own existence.. a few good hands at poker is selling that a little short!

Only if you consider it the only successful end result and ignore the mechanisms for self correction.

 

[Guy Threepwood]

That isn't an objective method of measurement. How do you detect the corruption or function?

You seem to be shifting between undefined terms for the same thing.

How do you detect the corruption or function?

How yy you dzsget the terte or ffsdffdfd?

You tell me, how can you tell which piece of information I corrupted?

Again the archaeologist and forensic scientist works from defining mechanisms and looking for familiar patterns.

We don't have anything like that for DNA and life.

That was certainly true in Darwin's day- not anymore

After Watson and Crick, we know that genes themselves, within their minute internal structure, are long strings of pure digital information. What is more, they are truly digital, in the full and strong sense of computers and compact disks, not in the weak sense of the nervous system. The genetic code is not a binary code as in computers, nor an eight-level code as in some telephone systems, but a quaternary code, with four symbols. The machine code of the genes is uncannily computerlike. Apart from differences in jargon, the pages of a molecular-biology journal might be interchanged with those of a computer-engineering journal. . . .

Richard Dawkins

This is a common and poor analogy for the evolution of life.

The chances of pulling 3 royal flushes in a row is trivial if you get to replace one card at a time repeatedly until you get the final result.

Exactly, that would be called cheating

And what Dawkins demonstrates in the 'Weasel program' - as long as you have the outcome predetermined, of course you can use trial and error to achieve it.

No single example of life is the only option for the situation it is in. Every step of the way might have given a different slightly different but successful option.

Using your wall analogy the internal structure of a diamond is perfectly regular, but stainless steel is a churned up mess of metals.

Only if you consider it the only successful end result and ignore the mechanisms for self correction.

I think we agree on that point then. it's not about complexity but what is specified.

self correction- natural selection, is still only a selection mechanism, an inherently destructive mechanism, not a stand in for a creative mechanism

 

[Frank Robert]

'errors' can be a rather subjective label.. a caveman might look at a smart phone and say- what a lousy arrowhead..

You can be pretty certain that a caveman would say something similar because he would have no knowledge of a smart phone. On the other hand, an omni deity or an intelligent designer who has total knowledge would have no problem designing perfect arrowheads, smart phones, archaea, bacteria, and eukaryotehumans including humans.

But to take the first example of imperfection in the book's summary 'eyes'

I remember being taught this (bad) 'design argument' in school as a convincing argument for Darwinian evolution. Why would light have to pass through extra layers of tissue before hitting receptors? After all cephalopods don't have this.

Many of these 'bad design' examples date back to fairly crude Victorian age dissections, long before it was discovered that the light is passing through highly specialized elongated cells which act as fiber-optic filters, very efficiently filtering out blue on bright days and allowing us a better color balance of daylight.

And of course if you are hunting colorless objects at great depths and in near darkness.. you'd want every photon you can get.. so that's good design all round

Thank you for the excellent examples of selective pressures.

Ironically the Victorian age misunderstanding prevails to this day as a 'bad design' argument in schools, whereas teaching the 21st C scientific knowledge as a 'good design' argument could literally get you taken away in handcuffs in the US!

Sounds a tiny bit hyperbolic. Intelligence design is not taught in schools for the simple reason it is not a recognized science because IDists have failed to put forth any authentic scientific hypothesis.

you can select exactly nothing into existence.

No one has claimed otherwise.

That leaves all creation to 'pure blind chance' (according to Darwinism)

I don't know about creation but you appear to have a much different comprehension of natural selection, selective pressures and other aspects of evolution than one finds in an elementary textbook on evolution.

 

[Tinker Grey]

How do you detect the corruption or function?

How yy you dzsget the terte or ffsdffdfd?

You tell me, how can you tell which piece of information I corrupted?

You tell me, how can you tell which piece of information I corrupted?
CAGGAGTAGAGTGACCCAACAGGAGCCATTGGAGGCAGGA
TTTGTAGTAAAAAGAGGGTTAAGTTCTCCCTGGTTCCTGA
GGTAGGTTGTGATAGGCTTGTTTGAATAATTTTGTGGAGT

 

[Guy Threepwood]

You can be pretty certain that a caveman would say something similar because he would have no knowledge of a smart phone. On the other hand, an omni deity or an intelligent designer who has total knowledge would have no problem designing perfect arrowheads, smart phones, archaea, bacteria, and eukaryotehumans including humans.


Thank you for the excellent examples of selective pressures.

Sure, I think we have common ground there

Sounds a tiny bit hyperbolic. Intelligence design is not taught in schools for the simple reason it is not a recognized science because IDists have failed to put forth any authentic scientific hypothesis.

I was taught about steady state since the Big Bang wasn't considered authentic science
But we didn't care because we were all doomed from global cooling anyway..

No one has claimed otherwise.

it seems often forgotten when people object to ToE relying on the pure blind chance of random mutation to originate everything-
They sometimes say I'm forgetting things like

.. natural selection, selective pressures and other aspects of evolution....

^ you still can't select anything into existence, no way around this

 

[Guy Threepwood]

You tell me, how can you tell which piece of information I corrupted?
CAGGAGTAGAGTGACCCAACAGGAGCCATTGGAGGCAGGA
TTTGTAGTAAAAAGAGGGTTAAGTTCTCCCTGGTTCCTGA
GGTAGGTTGTGATAGGCTTGTTTGAATAATTTTGTGGAGT

I believe that's a commonly misspelled town in the province of Nunavut.

 

[Frank Robert]

Sure, I think we have common ground there

Not if you are claiming selection blind luck.

Sounds a tiny bit hyperbolic. Intelligence design is not taught in schools for the simple reason it is not a recognized science because IDists have failed to put forth any authentic scientific hypothesis.

I was taught about steady state since the Big Bang wasn't considered authentic science
But we didn't care because we were all doomed from global cooling anyway..

The Big Bank and climate change have nothing to do with "Intelligence design" not taught in schools

it seems often forgotten when people object to ToE relying on the pure blind chance of random mutation to originate everything-

We know what you believe and no one is asking asking evidence for what you believe unless you are claim it's science.

They sometimes say I'm forgetting things
^ you still can't select anything into existence, no way around this

Nature does not need my help.

 

[Subduction Zone]

'pure blind chance' is actually the defining characteristic of Darwinism

Consider other theories of evolution;

Lamarckism
Creationism
Intelligent design
Natural engineering

All of these recognize natural selection as a given, survival of the fittest has never been controversial, only the arrival.

So what differentiates between them is their theory of the generative, the origination of that which selection has to act upon.

All of these have various explanations for that origination, only Darwinism relies on 'pure blind chance' aka random mutations

Incorrect, and I am sure that you have been corrected on this in the past. You are only looking at variation when it comes to evolution. You keep forgetting about natural selection. Natural selection is the opposite of "pure blind chance" and since it is a very significant part of evolution the process itself cannot be pure blind chance.

And the few times that you do pay attention to natural selection you pretend that variation does not exist.

Some times creationists try to debate by using half truths. For example:


Variation cannot account for evolution.

That is half true

Natural selection cannot account for evolution.

That is half true.

Natural selection and variation working together cannot account for . . . Oh bugger! Let's pretend I did not say that

 

[Subduction Zone]

To clarify:

At some point between a single celled (bacteria like) organism and a human being- some evolution must take place.

Darwinism claims that this can occur through random corruption of the genetic information within that less evolved life form.

Oh my so wrong. First off "Darwinism" would be pre-genetics. So you are wrong if you refer to genes at all and use that term. Darwin had no idea of what genes were, much less of how they worked.

And no one is claiming that it is due to a "corruption" either. When you lose loaded terminology you almost always lose the debate. You are making the error of assuming that genes were designed for a purpose without any scientific evidence for that belief. We know that genes can be mutated. And we know that sometimes those mutations are beneficial. A beneficial change is not a "corruption".

But you are quite right that thee was an awful lot of evolution between us and our single celled ancestors. Right now it appears that multicellular life arose about a billion years ago. That much time is a concept that people cannot grasp. But given the amount of time and the rate of change needed it is not at all out of the realm of possibility for life as we know it to have arrived. And the modern theory of evolution is the only idea that is supported by scientific evidence.

At least that is the modern synthesis of the Victorian age theory.

And the modern synthesis is not "Darwinism". People usually use that term because part of their arguments tend to be ad hominem fallacies.

What we actually observe scientifically, empirically though, is that mutations are overwhelmingly destructive- they lead to decline over time, fish losing sight, birds losing flight, bacteria losing the ability to digest certain compounds etc etc.

No. That is totally wrong. What we actually observe empirically is that the vast majority of mutations are benign. A small percentage of them are deleterious, and an even smaller number are beneficial. It only takes a very small percentage of positive mutations for evolution to occur.

This concurs with the fossil record wherein new biological form generally appears suddenly and in complete form, then remains in stasis and/or decline until extinction- or it is still here.

And this is wrong. The fossil record, especially for land based life, is not continuous. And as a result we do not expect to usually see small evolutionary changes. But there are examples of periods of extended deposition where we can see such changes in a genus. New species developing out of older ones. Even with some land based species we have a good record that shows speciation. With horse evolution we have an amazing record. That is an example that creationists love to quote mine about. The early simplified models shown in museums were "wrong". Not due to them not happening as creationists liked to pretend. But because the actual story is much more complex than that. Even a mere thirty or forty years ago there were over 50 species of "horses" found. It is probably double that by now. And even when it comes to man's evolution the creationists cannot draw an undisputed line between "ape" and "man".

 

[Guy Threepwood]

Not if you are claiming selection blind luck.

we all agree on natural selection. It's never been about the survival of the fittest, but the arrival of the fittest. For which Darwinism offers pure blind chance

The Big Bank and climate change have nothing to do with "Intelligence design" not taught in schools
We know what you believe and no one is asking asking evidence for what you believe unless you are claim it's science.

Nature does not need my help.

[science] such wholesale returns of conjecture out of such a trifling investment of fact. Mark Twain

 

[Guy Threepwood]

Oh my so wrong. First off "Darwinism" would be pre-genetics. So you are wrong if you refer to genes at all and use that term. Darwin had no idea of what genes were, much less of how they worked.

of course, which is why I described random mutation as being part of the modern synthesis of Darwinism.

To Darwin the cell was just a blob of protoplasm - he made no attempt to account for these information problems as he was entirely unaware of them. I do believe he would be a skeptic today based on his own standards.

And no one is claiming that it is due to a "corruption" either. When you lose loaded terminology you almost always lose the debate. You are making the error of assuming that genes were designed for a purpose without any scientific evidence for that belief. We know that genes can be mutated. And we know that sometimes those mutations are beneficial. A beneficial change is not a "corruption".

It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

'Mutated' is fine too, but talking of loaded terms; there is still a tendency for some to assume a sci/fi 'creature from the black lagoon' interpretation- where 'mutation' somehow tends to promote a 'bigger badder' version of itself- as popularized in the media.. not a particularly scientific understanding as I'm sure you agree

And yes of course that can be a benefit in certain circumstances. The corruption of certain genes in bacteria make it less susceptible to antibiotics, because the bacteria has lost the ability to break the poison down.

Just as it would be a benefit to you, if a hacker was trying to steal your info, but couldn't because your data had been already lost.

But you see the problem here re. evolving a human being out of a single celled organism... you can't simply corrupt your way to becoming a sentient mammal.

But you are quite right that thee was an awful lot of evolution between us and our single celled ancestors. Right now it appears that multicellular life arose about a billion years ago. That much time is a concept that people cannot grasp. But given the amount of time and the rate of change needed it is not at all out of the realm of possibility for life as we know it to have arrived. And the modern theory of evolution is the only idea that is supported by scientific evidence.

I take your point, but I think that was just a much stronger argument a few decades ago when I was still a pretty staunch Darwinist myself.. I remember arguing about the Cambrian, and how 100 million years was still a long time... I was genuinely surprised to find Wikipedia puts it at 13-25 mil now.. and that was before we knew a lot of what we know now about waiting times for coordinated mutations, and just how many are needed for even relatively simple morphology to occur.

And the modern synthesis is not "Darwinism". People usually use that term because part of their arguments tend to be ad hominem fallacies.

Well Dawkins refers to himself as a Darwinist.. so you may be on to something there!

No. That is totally wrong. What we actually observe empirically is that the vast majority of mutations are benign. A small percentage of them are deleterious, and an even smaller number are beneficial. It only takes a very small percentage of positive mutations for evolution to occur.

hmm.. if you are referring to what are called 'neutral' mutations- they are generally defined as not presenting an 'appreciable' effect- but this leaves a lot of wiggle room- within which still vastly more 'non-appreciable effects would lean deleterious v advantageous. Hence 'non-appreciable' is one of the problems here- how does the almighty natural selection weed out 'insignificant' disadvantages over time to stop them accumulating?

And this is wrong. The fossil record, especially for land based life, is not continuous. And as a result we do not expect to usually see small evolutionary changes. But there are examples of periods of extended deposition where we can see such changes in a genus. New species developing out of older ones. Even with some land based species we have a good record that shows speciation. With horse evolution we have an amazing record. That is an example that creationists love to quote mine about. The early simplified models shown in museums were "wrong". Not due to them not happening as creationists liked to pretend. But because the actual story is much more complex than that. Even a mere thirty or forty years ago there were over 50 species of "horses" found. It is probably double that by now. And even when it comes to man's evolution the creationists cannot draw an undisputed line between "ape" and "man".

I can't speak for creationists but credit where it is due, I don't think they fell for Piltdown man as Darwinists did, or any other of a number of false missing links- As Raup said, evolution occurred if we define it simply as change over time, but that does not tell us how it occurred.

I appreciate the thoughtful responses minus a couple of minor ad hom swipes!

 

[Bradskii]

we all agree on natural selection. It's never been about the survival of the fittest, but the arrival of the fittest.

That IS natural selection. If, as you say, a 'fittest' arrives in any given population (by chance) that literally means it's best suited for the environment in which it finds itself. So it is 'selected' for survival. And the organism, be it fish, fowl or chimp, will generally be around long enough to select a mate and pass on whatever genes made it the fittest in the first place. So the genetic traits (the ones that made it fitter) are propogated through the population. So we then declare those genetic changes to be beneficial.

It might have been a genetic propensity for growing a thicker coat. Is that a positive, neutral or negative change? It cannot be declared one or the other unless it suits the changes (if any) in the environment. If the climate is warming, then it's negative. If it's cooling, it's positive.

 

[Subduction Zone]

It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

Only if the original data is absolutely needed as written. That is not the case with life. It is an inappropriate use of loaded language. Computers are a bit different than life. A change in the code can easily be fatal or deleterious. Where change in DNA is quite often without a negative result. And sometimes it has a positive result. That is not corruption.

'Mutated' is fine too, but talking of loaded terms; there is still a tendency for some to assume a sci/fi 'creature from the black lagoon' interpretation- where 'mutation' somehow tends to promote a 'bigger badder' version of itself- as popularized in the media.. not a particularly scientific understanding as I'm sure you agree

But no one does that on the evolution side. This is a strawman argument. Of course when you construct a false debate it is easy to "refute".

And yes of course that can be a benefit in certain circumstances. The corruption of certain genes in bacteria make it less susceptible to antibiotics, because the bacteria has lost the ability to break the poison down.

Oops, you lost again by using the word "corruption" and ironically using it to state an increase in surviability.

Just as it would be a benefit to you, if a hacker was trying to steal your info, but couldn't because your data had been already lost.

And once again, a computer program is a poor analogy when it comes to evolution. They do not function in the same manner as DNA does with life.

But you see the problem here re. evolving a human being out of a single celled organism... you can't simply corrupt your way to becoming a sentient mammal.

Whew! It is lucky for us that evolution does not rely on "corruption".

You do like to shoot yourself in the foot at times, don't you?

I take your point, but I think that was just a much stronger argument a few decades ago when I was still a pretty staunch Darwinist myself.. I remember arguing about the Cambrian, and how 100 million years was still a long time... I was genuinely surprised to find Wikipedia puts it at 13-25 mil now.. and that was before we knew a lot of what we know now about waiting times for coordinated mutations, and just how many are needed for even relatively simple morphology to occur.

I do not think that it was ever 100 million years. And for the changes that arose why do you think that 13-25 million is not enough? Do you even know what is thought to have triggered the Cambrian explosion?

Well Dawkins refers to himself as a Darwinist.. so you may be on to something there!




hmm.. if you are referring to what are called 'neutral' mutations- they are generally defined as not presenting an 'appreciable' effect- but this leaves a lot of wiggle room- within which still vastly more 'non-appreciable effects would lean deleterious v advantageous. Hence 'non-appreciable' is one of the problems here- how does the almighty natural selection weed out 'insignificant' disadvantages over time to stop them accumulating?

No, we know that most mutations are neutral since most of the genome is noncoding DNA. A mutation does nothing. I suppose it could possibly switch some DNA back on and have a negative result. But that would be a rarity.

I can't speak for creationists but credit where it is due, I don't think they fell for Piltdown man as Darwinists did, or any other of a number of false missing links- As Raup said, evolution occurred if we define it simply as change over time, but that does not tell us how it occurred.

It was mainly the British scientists that fell for Piltdown Man. National pride and all of that. In much of Europe he was looked on with a bit of doubt. And of course creationists did not "fall" for it. When it comes to the biology they are pretty much science deniers. Anything that threatens their personal beliefs will be denied. Now if they could have refuted Piltdown man then you could make a positive claim about them. But when one is in automatic denial mode one will deny the good along with the bad.

 

[klutedavid]

This is very true. Seeing our solar system in VR for the first time blew my mind with just how huge it is.

And the size of our sun is terrifying.

How many Earths in the Sun?

1.3 million Earths.

The volume of the sun is 1.41 x 1018 km3, while the volume of Earth is 1.08 x 1012 km3. If you divide the volume of the sun by the volume of the Earth, you get that roughly 1.3 million Earths can fit inside the sun.

I struggle to believe that.

 

[Subduction Zone]

How many Earths in the Sun?

1.3 million Earths.

The volume of the sun is 1.41 x 1018 km3, while the volume of Earth is 1.08 x 1012 km3. If you divide the volume of the sun by the volume of the Earth, you get that roughly 1.3 million Earths can fit inside the sun.

I struggle to believe that.

The Sun has a diameter only 109 times bigger than the Earths. But people quite often forget that volume is proportional to diameter cubed (or radius cubed, it amounts to the same thing). But take 109 to the third power and what do you get? 1.295 million. Let's round it up and call it 1.3 million.

 

[Frank Robert]

we all agree on natural selection. It's never been about the survival of the fittest, but the arrival of the fittest. For which Darwinism offers pure blind chance

Darwin died in 1882, the ToE based on Darwin's fundamental discoveries is now one of the best-substantiated theories in the history of science. I have no idea why you do not comprehend that science is not static.

[science] such wholesale returns of conjecture out of such a trifling investment of fact. Mark Twain

Awesome projection. If anyone here has a trifling investment of fact it is you. You make many, many claims without a minuscule of facts. A trifling investment in learning the basics of evolution could benefit you immensely.

 

[tas8831]

You tell me, how can you tell which piece of information I corrupted?
CAGGAGTAGAGTGACCCAACAGGAGCCATTGGAGGCAGGA
TTTGTAGTAAAAAGAGGGTTAAGTTCTCCCTGGTTCCTGA
GGTAGGTTGTGATAGGCTTGTTTGAATAATTTTGTGGAGT

Isn't it odd that the creationist can never present actual genetic examples of their genetics claims....

 

[tas8831]

I have no idea why you do not comprehend that science is not static.

I do!

 

[Tinker Grey]

Isn't it odd that the creationist can never present actual genetic examples of their genetics claims....

Yup. That's an actual gene sequence for an actual thing. (I should've written down what it was, though.) And I did change something in it.

 

[tas8831]

To Darwin the cell was just a blob of protoplasm

Is that so? Can you document that in his writings?

- he made no attempt to account for these information problems as he was entirely unaware of them.

Information - what definition are you employing?

It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

If only DNA/genes operated exactly like computer software....
Problem is... maybe you should have read this post?



ANALOGY:

Definition of analogy

1a: a comparison of two otherwise unlike things based on resemblance of a particular aspect
b: resemblance in some particulars between things otherwise unlike : SIMILARITY

2: inference that if two or more things agree with one another in some respects they will probably agree in others

3: correspondence between the members of pairs or sets of linguistic forms that serves as a basis for
the creation of another form
​

When I used to teach Biology 101, I would use the classic English Language analogy when introducing students to DNA and Genetics.
Analogies are (or can be) good teaching tools to convey complex subjects to those who are unfamiliar with the subject matter, by making a comparison with that complex material and something more common and understandable.
It goes something like this - The Nucleotides are like letters, the Exons are like words, a Gene is like a sentence, a Genome is like a book, etc., at least that is how I approached it. This is all very simplistic (by design) , but it usually helps get the basic points across.
I was always sure to make it clear that this is pretty much where the analogy ends. I would explain that genes can be very different from sentences, that genomes, unlike books, contain lots of 'chapters' repeated over and over, or parts of them repeated, etc. But again, the analogy was good enough to get the basics across.

It seems that many people never got that caution, and were apparently told, or it was implied, or they need it to be so that the analogy is almost exactly a 1-to-1 directly applicable comparison. And many of those same folks read a book or more likely an internet essay about "genetic information", where direct analogies - just as inapplicable as the language analogies - are employed in which it is asserted that genes/genomes are exactly like computer code, and subject to the exact same constraints. This is why, for example, we see creationists - even on this forum, even today - claiming, for example that "rearranging the things that are already there is not new information". That claim is usually accompanied by something like "and you need new information to make a new part." I have even seem some intrepid anti-evolutionists provide specific (and wholly indefensible) numbers - one fellow claimed on another forum many years ago that 'we' needed at least 1 "brand new protein" to make a new body part, and that this required at least 333 mutations-worth of new information. I asked why, and how he knew this, but I never got a reply (of course). I also once had a rather well-known (at least on the internet) creationist declare that 'we' would need at least 1 million mutations to turn an ape pelvis into a human one. I asked for a list of 10 of these changes that were needed and how many mutations each would require and how he knew this. No answer, and it has been about 11 years... Anyway:

These language/computer code/ "information" constraints that are foisted upon evolution include (but are definitely not limited to):

1. You cannot just rearrange what is there and get anything new
2. You cannot just copy-paste what is already there and get anything new
3. You cannot screw up the code/word and expect something new or good to come of it

I first encountered the language analogy argument against evolution way back in the early 1990s, in the first creationism book I ever read. I don't remember the book, specifically, but I later learned that the example in this book had made the rounds and was pretty common amongst creationists. It went something like this, and it basically encompasses the three constraints above:

Here is a simple sentence:

The dog ran fast.

Now let us 'evolve' it:

The dog ran fast. The dog ran fast.

The dog dog ran fast.

The ran dog fast.

The dig ran fast.

Isn't that CRAZY??? Those sentences don't make any sense! Obviously, this is not how evolution works. Because it DOESN'T work!​

In reality, we see:

The dog ran fast. The dog ran fast.

Diet and the evolution of human amylase gene copy number variation
Abstract
Starch consumption is a prominent characteristic of agricultural societies and hunter-gatherers in arid environments. In contrast, rainforest and circum-arctic hunter-gatherers and some pastoralists consume much less starch1,2,3. This behavioral variation raises the possibility that different selective pressures have acted on amylase, the enzyme responsible for starch hydrolysis4. We found that copy number of the salivary amylase gene (AMY1) is correlated positively with salivary amylase protein level and that individuals from populations with high-starch diets have, on average, more AMY1 copies than those with traditionally low-starch diets. Comparisons with other loci in a subset of these populations suggest that the extent of AMY1 copy number differentiation is highly unusual. This example of positive selection on a copy number–variable gene is, to our knowledge, one of the first discovered in the human genome. Higher AMY1 copy numbers and protein levels probably improve the digestion of starchy foods and may buffer against the fitness-reducing effects of intestinal disease.




The dog dog ran fast.

Common exon duplication in animals and its role in alternative splicing
Abstract
When searching the genomes of human, fly and worm for cases of exon duplication, we found that about 10% of all genes contain tandemly duplicated exons. In the course of the analyses, 2438 unannotated exons were identified that are not currently included in genome databases and that are likely to be functional. The vast majority of them are likely to be involved in mutually exclusive alternative splicing events. The common nature of recent exon duplication indicates that it might have a significant role in the fast evolution of eukaryotic genes. It also provides a general mechanism for the regulation of protein function.


The ran dog fast.

Evolutionary history of exon shuffling
Abstract
Exon shuffling has been characterized as one of the major evolutionary forces shaping both the genome and the proteome of eukaryotes. This mechanism was particularly important in the creation of multidomain proteins during animal evolution, bringing a number of functional genetic novelties. Here, genome information from a variety of eukaryotic species was used to address several issues related to the evolutionary history of exon shuffling. By comparing all protein sequences within each species, we were able to characterize exon shuffling signatures throughout metazoans. Intron phase (the position of the intron regarding the codon) and exon symmetry (the pattern of flanking introns for a given exon or block of adjacent exons) were features used to evaluate exon shuffling. We confirmed previous observations that exon shuffling mediated by phase 1 introns (1-1 exon shuffling) is the predominant kind in multicellular animals. Evidence is provided that such pattern was achieved since the early steps of animal evolution, supported by a detectable presence of 1-1 shuffling units in Trichoplax adhaerens and a considerable prevalence of them in Nematostella vectensis. In contrast, Monosiga brevicollis, one of the closest relatives of metazoans, and Arabidopsis thaliana, showed no evidence of 1-1 exon or domain shuffling above what it would be expected by chance. Instead, exon shuffling events are less abundant and predominantly mediated by phase 0 introns (0-0 exon shuffling) in those non-metazoan species. Moreover, an intermediate pattern of 1-1 and 0-0 exon shuffling was observed for the placozoan T. adhaerens, a primitive animal. Finally, characterization of flanking intron phases around domain borders allowed us to identify a common set of symmetric 1-1 domains that have been shuffled throughout the metazoan lineage.


The dig ran fast.

Point Mutations with Positive Selection Were a Major Force during the Evolution of a Receptor-Kinase Resistance Gene Family of Rice
ABSTRACT
The rice (Oryza sativa) Xa26 gene, which confers resistance to bacterial blight disease and encodes a leucine-rich repeat (LRR) receptor kinase, resides at a locus clustered with tandem homologous genes. To investigate the evolution of this family, four haplotypes from the two subspecies of rice, indica and japonica, were analyzed. Comparative sequence analysis of 34 genes of 10 types of paralogs of the family revealed haplotype polymorphisms and pronounced paralog diversity. The orthologs in different haplotypes were more similar than the paralogs in the same haplotype. At least five types of paralogs were formed before the separation of indica and japonica subspecies. Only 7% of amino acid sites were detected to be under positive selection, which occurred in the extracytoplasmic domain. Approximately 74% of the positively selected sites were solvent-exposed amino acid residues of the LRR domain that have been proposed to be involved in pathogen recognition, and 73% of the hypervariable sites detected in the LRR domain were subject to positive selection. The family is formed by tandem duplication followed by diversification through recombination, deletion, and point mutation. Most variation among genes in the family is caused by point mutations and positive selection.

I also looked at a couple papers on the Titin gene, as I had remembered from some years ago a discussion on that on a forum, but I could not find the paper I had used before. I did, however, come across this figure - all the red blocks are identical or nearly identical Ig-like domains:

Largest protein we make. LOTS of what we are told is not 'new information' and just 'copies of what is already there' jammed together to make a gene that makes an important protein.


That handles both the language and 'information' "arguments via analogy", I believe, but there is one more 'information' issue that I would like to address - the claim that 'just changing what is already there does not create new information, therefore, no adaptive evolution can occur' or words to that effect.

This paper documents an insertion event (a mutation in which a large chunk of DNA is inserted in one event) within the promoter region of a gene which causes the gene to be over-transcribed, i.e., just more of the same protein is made. No 'new' protein, just "information" that makes more of it. And it confers an adaptive benefit:

A single p450 allele associated with insecticide resistance in Drosophila.
"...Transgenic analysis of Cyp6g1 shows that over-transcription of this gene alone is both necessary and sufficient for resistance. Resistance and up-regulation in Drosophila populations are associated with a single Cyp6g1 allele that has spread globally. This allele is characterized by the insertion of an Accord transposable element into the 5' end of the Cyp6g1 gene."

I'm sure the fallacy-mongers will be out in force (if they do not just ignore it all) and try to find ways to diminish or deny - I have presented the p450 many times, once had a creationist dismiss it because it did not produce a 'new limb'!! :facepalm:
:shrug:
That analogies are not evidence will be their burden to bear.



It would really help your cause if you knew enough about the ACTUAL science rather than your analogy-driven PRATT-based regurgitation.