For those wondering what "macroevolution" actually is...

[tas8831]

Yup. That's an actual gene sequence for an actual thing. (I should've written down what it was, though.) And I did change something in it.

My gosh - HOW TO TELL????

Reminds me of one of my old antics in replying to the folks claiming to be totally knowledgeable about genetics and to be able to measure "information" - I would post the sequence for an entire gene and ask them to tell me how much information there is in it, and what it does. Without fail, if they replied at all, it would be to ask me what the sequence was...

 

[tas8831]

It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

This might be of interest to you wrt your analogies and definitions:

As someone who writes code to study genetics for a living (my job title is 'senior computational scientist')... yeah. To the extent that genetics does resemble software, it resembles software that wasn't designed, that is riddled with redundancies, unused, dead code, patches to repair earlier bugs, and multiple modules doing similar things that look like they were written by different people.​

 

[Subduction Zone]

You tell me, how can you tell which piece of information I corrupted?
CAGGAGTAGAGTGACCCAACAGGAGCCATTGGAGGCAGGA
TTTGTAGTAAAAAGAGGGTTAAGTTCTCCCTGGTTCCTGA
GGTAGGTTGTGATAGGCTTGTTTGAATAATTTTGTGGAGT

I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?

 

[Bradskii]

I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?

Isn't it so weird when you only get the one result.

Hmm. Tried changing one letter and pasted the sequence into this post (now obviously edited out), saved changes and did a Google search - and it couldn't find it.

 

[Subduction Zone]

Isn't it so weird when you only get the one result.

Hmm. Tried changing one letter and pasted the sequence into this post (now obviously edited out), saved changes and did a Google search - and it couldn't find it.

He created his own unique internet baby

 

[FrumiousBandersnatch]

To clarify:

At some point between a single celled (bacteria like) organism and a human being- some evolution must take place.

Darwinism claims that this can occur through random corruption of the genetic information within that less evolved life form.

At least that is the modern synthesis of the Victorian age theory.

What we actually observe scientifically, empirically though, is that mutations are overwhelmingly destructive- they lead to decline over time, fish losing sight, birds losing flight, bacteria losing the ability to digest certain compounds etc etc.

This concurs with the fossil record wherein new biological form generally appears suddenly and in complete form, then remains in stasis and/or decline until extinction- or it is still here.

This is false. Beneficial mutations can occur in non-functional parts of the genome, or restore function that was lost. The result may be advantageous loss of redundant or obsolete function, or advantageous gain of lost or new function. There is also a selection effect for naive observers, in that vestigiality is often more obvious than exaptation or the slow evolution of novel traits

 

[Tinker Grey]

I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?

Well when I get back to work on Monday, I can check my search history and let you know.

....OOOOOH (the penny drops). Google found this.
Prolly cuz of the change

 

[Subduction Zone]

Well when I get back to work on Monday, I can check my search history and let you know.

....OOOOOH (the penny drops). Google found this.
Prolly cuz of the change

Exactly! If you had not made a change it could have been found at quite a few sites. Your version appears to be unique, and that is rather hard to accomplish today.

 

[Tinker Grey]

Exactly! If you had not made a change it could have been found at quite a few sites. Your version appears to be unique, and that is rather hard to accomplish today.

I am not exactly sure that's it. I tried searching just a section of that I was pretty sure I hadn't changed and it still found only this website. I suspect that the portion I snipped wasn't "indexable" by Google? Well, I'll check my history Monday and we'll see.

 

[Bradskii]

Exactly! If you had not made a change it could have been found at quite a few sites. Your version appears to be unique, and that is rather hard to accomplish today.

'A Googlewhack is a contest to find a Google Search query that returns a single result. A Googlewhack must consist of two words found in a dictionary, and is only considered legitimate if both of the search terms appear in the result.' Wiki

 

[FrumiousBandersnatch]

I am not exactly sure that's it. I tried searching just a section of that I was pretty sure I hadn't changed and it still found only this website. I suspect that the portion I snipped wasn't "indexable" by Google? Well, I'll check my history Monday and we'll see.

Try searching the Library of Babel for it

 

[Tinker Grey]

I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?

Thanks to @FrumiousBandersnatch for reminding me: 15000 bp downstream from il2 gene - Wolfram|Alpha

See "Reference sequence at location". The section isn't "text". I had to select the button "Plain Text" so I could copy it for my post.

 

[tas8831]

I believe that's a commonly misspelled town in the province of Nunavut.

Ah - the old "I'll make a stupid joke when my bluff is called on something that I present myself as having superior knowledge on"...

Typical creationist.

 

[tas8831]

Yup. That's an actual gene sequence for an actual thing. (I should've written down what it was, though.) And I did change something in it.

As I've suspected all along - he's just another bloviating YEC hoping to bluff his way through an "argument" with people better informed on the subject.

 

[tas8831]

It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

If only genomes/genetics really did function EXACTLY like you computer software... You can't - or won't - even consider that the possibility that your repetitious regurgitation of an argument via false analogy might not be the winner your proudly believe it to be.

Never taken a biology class, much less a genetics class, have you?

The Phil Johnson effect...

 

[Buzzard3]

Macroevolution is NOT 'an event' that needs to be 're-created.' It is an observed pattern.

Macroevolution is not an "observed" anything - it has never been observed and is nothing more than an assumption.

Furthermore, thousands of years of humans experimenting with microevolution - in the form of animal and plant breeding - strongly suggest that macroevolution is a scientific impossibility.

 

[AV1611VET]

Macroevolution is not an "observed" anything - it has never been observed and is nothing more than an assumption.

Macroevolution is nothing more than a game of connect-the-dots that only looks good on paper.

 

[Buzzard3]

Macroevolution is nothing more than a game of connect-the-dots that only looks good on paper.

Well said. It's more wishful thinking than science.

Consider dog breeders, for example, who have over thousands of years tried every trick imaginable in their attempts to produce novel breeds, but they've discovered that exploiting genetic variations has limits ... push the envelope too far and the result is sickly, weak, unfit dogs - that is devolution, the opposite of evolution!
In the light of such genetic limitations, macroevolution (by natural means) appears to be nothing more than a unscientific fantasy.

 

[AV1611VET]

Nice to meet you, Buzzard! Welcome to CF!

 

[Buzzard3]

Nice to meet you, Buzzard! Welcome to CF!

Thank you. Nice to meet you too.