It depends on whom you talk to and what 'argument' you are trying to make.
Let us consider these hyptheticals.
Sequence from taxon 1:
ATTCGCTGATTGGCCATATTACGTA
Sequence from taxon 2:
ATTCGCTGATTGGCCAGGGCCCGGGGTATTACGTA
An insertion had occurred in taxon 2, of 10 bases.
A raw nucleotide divergence between the two is approximately 24%.
But the 10 inserted bases occurred all at once. Mutation-wise, they diverge at 4%.
There can only be two possible reasons for such an obvious error on arithmetic. Failure to comprehend the concept of ratios or a deliberate attempt to persuade people of an obvious false demonstration for sport. The two sequences only have 15 base pairs (BP) or nucleotides in common, they diverge by 14, the divergence is a ratio of same/different or 15/14. Thus the divergence is nearly 50% when comparing the two sequences. If this happens as the result of one or a dozen mutations dose not change the divergence (differences). The ratio is same/different.
You will have us accept the higher divergence, as best I can tell, solely because you believe it fits your argument better, that this higher divergence is a problem that evolution cannot explain (but it was 'explained' when it was discovered that indels are single events of multiple nucleotides).
No I would have you accept the divergence as about 4.43% because the Initial Sequence of the Chimpanzee Genome paper reports 1.43% due to substitution and 3% due to indel which comes to 4.43%. The reason that divergence that high is being misrepresented by Darwinians like Talk Origins isn't because there is confusion about the divergence as a percentage of the genome because there are uniformly right around 95-96%.
Not that it really matters - if your preferred method is employed universally, this will by necessity make ALL compared taxa diverge by larger amounts - even those creationists believe to have descended from a common "kind".
Oops.
Darwinians told us for a hundred years that there were various species and subspecies of humans. Since the DNA model led to direct comparisons of whole genome sequences we now know any two humans diverge by about 1/10th of 1%. Since the unveiling of the human genome projects landmark initial sequence paper in 2001 there have been at least half a dozen comparisons from whole genomes to whole chromosomes to brain related genes. No one is reporting divergence based on mutation events.
What you are saying is clearly and obviously wrong. This is the kind of thing the demonstrates that Darwinians lack the courage of their convictions. Your math is obviously wrong:
Now they do say that there are five million events but that doesn’t change the fact that the divergence is still 3% due to indels.
The conclusion is the old saw that we share 98.5% of our DNA sequence with chimpanzee is probably in error. For this sample, a better estimate would be that 95% of the base pairs are exactly shared between chimpanzee and human DNA. In this sample of 779 kb, the divergence due to base substitution is 1.4%, and there is an additional 3.4% difference due to the presence of indels. (Britten, R. J. Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels. Proc. Natl Acad.)
It says in no uncertain terms 5% counting indels, the number of events are irrelevant. This was well established before the Chimpanzee Genome paper:
By comparing the whole sequence with the human counterpart, chromosome 21, we found that 1.43% of the chromosome consists of single-base substitutions in addition to nearly 68,000 insertions or deletions. These differences are sufficient to generate changes in most of the proteins…Estimates of nucleotide substitution rates of aligned sequences range from 1.23% by bacterial artificial chromosome (BAC) end sequencing to about 2% by molecular analysis, whereas the overall sequence difference was estimated to be approximately 5% by taking regions of insertions or deletions (indels) into account. (DNA sequence and comparative analysis of chimpanzee chromosome 22)
Now the sequences that line up the divergence can be between 1.23% and 2% but when taking the indels into consideration, actually gaps in the sequence, it's 5%. Nowhere is the number of events taken into consideration and the Chimpanzee Genome paper confirms this with five previous studies. The research that followed also confirmed the divergence as a percentage as the same:
Humans and chimpanzees shared a common ancestor ∼5-7 million years ago (Mya). The difference between the two genomes is actually not ∼1%, but ∼4%—comprising ∼35 million single nucleotide differences and ∼90 Mb of insertions and deletions. (Comparing the human and chimpanzee genomes: Searching for needles in a haystack. Genome Research)
There are no exceptions, just a mild variance.
I know why Talk Origins and so many others want to conflate the basic arithmetic. It's because the divergence jumping from 1.43% to 5% makes the mutation rate too high due to deleterious effects. They committed the same shameless error in math you just did:
The difference between chimpanzees and humans due to single-nucleotide substitutions averages 1.23 percent, of which 1.06 percent or less is due to fixed divergence, and the rest being a result of polymorphism within chimp populations and within human populations. Insertion and deletion (indel) events account for another approximately 3 percent difference between chimp and human sequences, but each indel typically involves multiple nucleotides. The number of genetic changes from indels is a fraction of the number of single-nucleotide substitutions (roughly 5 million compared with roughly 35 million). So describing humans and chimpanzees as 98 to 99 percent identical is entirely appropriate (Chimpanzee Sequencing 2005). (
Talk Origins Claim CB144)
This clearly and directly contradicts the research reports in the peer reviewed scientific literature. The position is indefensible, grossly in error and accepted without qualification by Darwinian uninterested in the actual facts.
we estimate that the genomic deleterious mutation rate (U) is at least 3. This high rate is difficult to reconcile with multiplicative fitness effects of individual mutations and suggests that synergistic epistasis among harmful mutations may be common. (Estimate of the Mutation Rate per Nucleotide in Humans Michael W. Nachmana and Susan L. Crowella Genetics, 297-304, September 2000)
That's at 1.33%, what happens when it goes up the 5%?
Estimates of mutation rate assuming different divergence times and different ancestral population sizes…Calculations are based on a generation length of 20 years and average autosomal sequence divergence of 1.33%…(Estimate of the Mutation Rate per Nucleotide in Humans Michael W. Nachmana and Susan L. Crowella Genetics, 297-304, September 2000)
The explanation I get from someone who know what their talking about is this:
A mutation rate of 2.3 x 10^-8 per generation for each base pair in the genome (for substitutions) predicts the following. Humans are separated from the human/chimpanzee common ancestor by roughly 350,000 generations, and there are 3 x 10^9 base pairs in the genome, so we should expect to find 2.3 x 10-8 x 3 x 10^9 x 3.5 x 10^5 = 24 million accumulated mutations in humans in that amount of time. Add the same number in chimpanzees, and that mutation rate predicts 48 million single-base differences. That's a little higher than the 35 million observed single-base subsitution differences between humans and chimps (not surprising, since that mutation rate is at the upper end of estimates), but certainly in the right ball park. And the error is in the wrong direction, as far as you're concerned: the known mutation rate is more than enough to explain the observed differences between humans and chimps, not hopelessly inadequate, as you claim.
Do the same calculation for the indels. The estimated number of indel mutations should be 2.3 x 10^-9 x 3 x 10^9 x 3.5 x 10^5 = 2.4 million predicted indels in humans, and an equal number predicted in chimpanzees, for ~5 million predicted indel differences between them. The observed number of indel differences is (as you have pointed out several times) 5 million, exactly as predicted. (Do Chimps and Humans Share a Common Ancestor? Primer for a formal debate
Post 84)
If that's the explanation then why try to make the divergence, know to be 95% to 96% from the best research available out to be 98% and some change? It also comes to mind since the split was about 5 million years ago and our ancestors were continuously evolving we only diverge by less then 1%. It's the deleterious effects of mutations, they simply can't account for them so they simply pretend they are not there.
If I can't expect the known divergence to be honestly admitted when I know what it is, how am I supposed to expect clarification when something as complicated as mutation rates are calculated?
Have a nice day
Mark
![[serious]](/data/avatars/m/160/160873.jpg?1431539545){kind=avatar}
