The evidence for evolution for Kenny'sID thread

[Warden_of_the_Storm]

Because the Bible makes how God really created man (and all other life) clear.

We did not come from a single celled organism, (which came from who knows where) which then somehow evolved into increasingly complex life forms, until we ended up with our "common ape-like ancestor", from which point some kind of division took place, with man being the result on one end and all other primates on the other.

God created each species separate and unique. He created unique and distinct plants and animals, each able to produce after their own kind.

And as for mankind? We are not just another animal who shares a "common ancestor" with apes and monkeys. We were created in God's image, which all the other animals were not. In this way we are set apart from all other animals and from everything else in creation.

Darwinian evolution, on the other hand, completely rejects this.

I asked how you knew that Christians do not believe that man evolved from a common ancestor with apes. What you just gave me was what YOU believe.

 

[amariselle]

Yes, man. EXACTLY that. There are more Christians who accept the Theory of Evolution, in the way which scientists describe it, than there are Christians who believe in YEC, according to multiple polls.

Then these Christians are denying what the Bible actually says.

Oh, and I'm not a man.

 

[amariselle]

Yes, man. EXACTLY that. There are more Christians who accept the Theory of Evolution, in the way which scientists describe it, than there are Christians who believe in YEC, according to multiple polls.

Also, Young Earth Creation is about time only, it does NOT mean that Christians who don't believe in YEC reject that God created everything.

 

[Loudmouth]

Explain it to me then, clearly you have all the answers.

You already explained it before. Species stay in their kind. The common ancestor we share with chimps was a primate, and both chimps and us are still primates. The common ancestor we share with bears was a mammal, and we are still both mammals. The common ancestor we share with fish was a vertebrate, and we are both still vertebrates. Each new species stays on the same evolutionary branch that their ancestors were on. Darwin described macroevolution as descent with modification, and that is still a perfect description. The descendants of humans will be modified humans, just as we are still modified primates, modified mammals, and modified vertebrates.

The difference between macroevolution and microevolution is speciation. This is the process by which one population splits into two, and then stops interbreeding between the two new populations. This causes different microevolutionary events to accumulate in each population, and this leads to divergence between the populations. This is exactly what happened in the case of horses and donkeys, a perfect example of speciation that you discussed earlier.

As for the creationist concept of genetic information, it is entirely made up. They have no measure of genetic information. They have no way of measuring when genetic information increases or decreases. They simply have a mantra that they teach other creationists to say, which makes them sound sciency. It isn't science. For example, here is a DNA sequence:

TGACCTAACGGTAAGAGAGTCTCATAATGCGTCCGGCCGCGTGCCCAGGG

I will now change one base, highlighted in red:

TGACCTAACGGTAAGAGAGTGTCATAATGCGTCCGGCCGCGTGCCCAGGG

Did genetic information increase, decrease, stay the same? No creationist I have met can ever answer that question. They just claim that evolution can not add genetic information, and hope that no one asks the to support the claim with evidence.

 

[Loudmouth]

Then these Christians are denying what the Bible actually says.

They are denying your hyper-literal interpretation of the Bible.

Oh, and I'm not a man.

Pardon moi, madam.

 

[Loudmouth]

Not, however, evolution from a common ape-like ancestor, just another animal in the animal kingdom.

They accept that we share a common ancestor with other apes, and they accept that the process was evolution.

What next? Are you going to tell us that Christians reject gravity, and instead believe that God moves Earth about the Sun by his own hand? Why are you so against God acting through his creation?

 

[46AND2]

Also, Young Earth Creation is about time only, it does NOT mean that Christians who don't believe in YEC reject that God created everything.

That's fine. There are far more YEC than there are OEC, so the point remains.

 

[Loudmouth]

Because the Bible makes how God really created man (and all other life) clear.

I remember someone saying the same thing about the movement of the Earth.

"First, . . . to want to affirm that in reality the sun is at the center of the world and only turns on itself without moving from east to west, and the earth . . . revolves with great speed about the sun . . . is a very dangerous thing, likely not only to irritate all scholastic philosophers and theologians, but also to harm the Holy Faith by rendering Holy Scripture false."--Cardinal Bellarmine, 1615

Creationists are the modern day Geocentrists.

If you insist that the Bible can not accommodate evolution, then all you are doing is showing that the Bible was not inspired by a deity that was involved with life on Earth. If the Bible does not match the facts, it isn't the facts that are wrong.

 

[46AND2]

Then these Christians are denying what the Bible actually says.

no, they are denying your interpretation of what it says.

Oh, and I'm not a man.

My apologies. It was more of a figure of speech. I had that meme of The Dude from The Big Lebowski stuck in my head after seeing it on one of the threads in here...lol

 

[amariselle]

They accept that we share a common ancestor with other apes, and they accept that the process was evolution.

What next? Are you going to tell us that Christians reject gravity, and instead believe that God moves Earth about the Sun by his own hand? Why are you so against God acting through his creation?

Ha ha, that's amusing. I'm sorry, if you think I'm "against God acting through His creation," you haven't understood anything I've written.

Of course He acts through His creation. It's His creation!

Creation tells us about our Creator every single day. That doesn't change that He did in fact create man separate and distinct from all other animals. And he created each animal and plant to produce more of their own kind. When they do, they bring glory to Him, as they are doing just what He made them to do.

 

[Loudmouth]

Ha ha, that's amusing. I'm sorry, if you think I'm "against God acting through His creation," you haven't understood anything I've written.

Of course He acts through His creation.

Then why do you say that evolution is an attempt to take God out of the creation?

Creation tells us about our Creator every single day.

Yes, it tells us that life evolved, including humans.

That doesn't change that He did in fact create man separate and distinct from all other animals.

Based on what evidence?

 

[amariselle]

That's fine. There are far more YEC than there are OEC, so the point remains.

Yes, perhaps so, but OEC or YEC can and do both contain those who still believe in Biblical creation.

 

[amariselle]

Then why do you say that evolution is an attempt to take God out of the creation?

Not evolution in general, the kind of evolution that claims God didn't create anything, but that we are the result of random chance. That view does in fact "take God out of creation," and it denies His word.

Yes, it tells us that life evolved, including humans.

God created mankind, we did not evolve from a common ancestor with apes. We were created by God, separate and unique.

Based on what evidence?

The Holy Bible

 

[46AND2]

Yes, perhaps so, but OEC or YEC can and do both contain those who still believe in Biblical creation.

Yes. And there are more Christian Theistic Evolutionists (those who accept science's version of evolution) than there are YEC and OEC combined.

 

[46AND2]

Not evolution in general, the kind of evolution that claims God didn't create anything, but that we are the result of random chance. That view does in fact "take God out of creation, and it denies His word.

No it doesn't. Why couldn't God have used evolution to create all his kinds after starting simple life?

 

[Loudmouth]

Not evolution in general, the kind of evolution that claims God didn't create anything,

But you just said that God can act through his creation. You aren't being consistent. Why can't God create through evolution just as God moves the Earth about through gravity?

but that we are the result of random chance.

Why can't God act through what we observe as random chance?

That view does in fact "take God out of creation," and it denies His word.

It only denies your false interpretation of the Bible.

God created mankind, we did not evolve from a common ancestor with apes. We were created by God, separate and unique.

Those are your words, not God's.

The Holy Bible

That is the claim, not the evidence.

Are you saying that this whole time you knew you didn't have any scientific evidence? This whole time, you knew there was nothing for scientists to ignore?

 

[Loudmouth]

I still find it strange that creationists think God is so incapable that God can't even use evolution. Even more, God is so incapable that God can't produce a universe capable of evolving humans, in the eyes of creationists.

 

[amariselle]

But you just said that God can act through his creation. You aren't being consistent. Why can't God create through evolution just as God moves the Earth about through gravity?

Why can't God act through what we observe as random chance?

It only denies your false interpretation of the Bible.

Those are your words, not God's.

That is the claim, not the evidence.

Are you saying that this whole time you knew you didn't have any scientific evidence? This whole time, you knew there was nothing for scientists to ignore?

If you want to know how God truly acts through His creation and what creation is in fact all about, read the Bible. It's very clear that this earth and everything on it is NOT the result of random chance.

 

[Loudmouth]

If you want to know how God truly acts through His creation and what creation is in fact all about, read the Bible.

I have, and nowhere does it say that humans did not come about through evolution.

Also, why can't we look at the evidence in the creation itself? Did God fake the evidence in an attempt to fool us?

It's very clear that this earth and everything on it is NOT the result of random chance.

Based on what evidence?

 

[amariselle]

I still find it strange that creationists think God is so incapable that God can't even use evolution. Even more, God is so incapable that God can't produce a universe capable of evolving humans, in the eyes of creationists.

You are twisting what "creationists" actually believe.

We don't in fact believe that God is "incapable", we believe He is entirely capable, and that He made the world and everything in it a certain way, and He made it to work a certain way, to His glory.

Just because we don't believe He left it all to random chance, does not mean we think He is "incapable." He did in fact have a very definitive plan when He created everything.

And it's all the more amazing because of that. Everything we see is the work of His hands, NOT the product of random and haphazard evolution. No, everything in our world was created with a purpose and by a loving and creative God.