GULO Pseudogene as evidence for common ancestry among primates

[sfs]

Actually, there do appear to be two that do just that.

Which positions are those? I'm not seeing them.

 

[Chalnoth]

Which positions are those? I'm not seeing them.

Here I've highlighted them in blue:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC
AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC
GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC

 

[sfs]

Here I've highlighted them in blue:
[/font]

Sorry, I spotted them after I posted -- too little sleep from staying up to watch election results. At least one, and probably both, are multiple mutations in different lineages at CpG sites (sites where a C is followed directly by a G). CpG's have a very high mutation rate, to either TG or CA (the same mutation, actually, but on the two different strands the results look different). This is why potential CpG sites are often removed from analyses, since they tend to muck things up.

 

[Chalnoth]

CpG's have a very high mutation rate, to either TG or CA (the same mutation, actually, but on the two different strands the results look different). This is why potential CpG sites are often removed from analyses, since they tend to muck things up.

I thought there might be some interesting information about how mutations operate here.

 

[shernren]

I also like it because it really makes the creationists show their true stripes. The first time I saw this evidence presented I realized that creationists aren’t seeking truth after all. Even when they fully understand the evidence at hand they somehow block it out and hang all hope on the idea that these shared mutations happened coincidentally in independently created species rather than change their a priori beliefs.

True. I can't believe I'm sick of Christianity.com after just a week there but look at this: http://forums.christianity.com/m_1810390/mpage_5/tm.htm (I introduced GULOP at post #111) ... terrifying. Compared to here, Christianity.com is far worse ... here at least the creationists are relatively serious (such as mark, IMHO) or they know that half their business here is having fun with their own wacky ideas. Over there they're so mock serious and yet don't cite papers (other than a recurring "biological machines" cut-and-paste by an avid ID fan), don't do independent research (I have a falsifiable hypothesis there still waiting to be falsified), and ironically think evolution has the power to utterly rewrite phylogenies. This particular one was priceless:

We could move a step up and look at HERVs. Essentially the same idea - homologous ERVs are found at the exact same locations in chimp and human genomes, but not in other primates', or they are found at the exact same locations in all great apes without any exceptions, etc. ERVs make up 8% of the human genome - and to assign all of that to random independent invasions of primate lineages would be quite silly.
​

Where "quite silly" means accepting the highly improbable as true, no?
However, there is really no benchmark by which to compare the probability of random mutation producing the effect vs. common descent producing the effect.

He clearly has never heard of HERVs, or else he would be straightaway pulling a mark "I don't believe that's virus" - "no benchmark" he says ...

 

[theFijian]

I do not even know what glyphosate is so how can that be evidence for anything

I think all Creationists should be using this argument to refute evolution. "I dont know what you're talking about therefore it aint true"....genius.

 

[Loudmouth]

Using the GeneBee ClustalW phylogenetic analysis webserver, I put in the human, chimp, orang, and macaque sequences. Attached is the resulting tree. Its 301 kb, so beware.

 

[Ondoher]

Using the GeneBee ClustalW phylogenetic analysis webserver, I put in the human, chimp, orang, and macaque sequences. Attached is the resulting tree. Its 301 kb, so beware.

Imagine that, agreement between independent phylogenies. Almost as if there is a true family tree of living things.

 

[super animator]

Can anyone explain to me why it's such a big deal? Apparently my brains is dead at the moment, and I need someone to elaborate all this for me.

 

[LifeToTheFullest!]

It's a big deal because H. sapiens are unable to synthesize vitamin C, however, as you know, we get a horrible connective tissue disease if we don't eat citrus (vit. C).

All other primates have the gene that allows them to synthesize vitamin C. It is essentially a genetic mutation in the genome of H. sapiens that prevents us from synthesizing vit. C.

Basically, humans have the gene that codes for vit. C synthesis, but it's 'turned off.'

It is just one of many mutations in our genome suggesting we are closely related to other primates, specifically chimps.

 

[MarkT]

Here is a genetic sequence from an organism with a working GULO gene:

GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC
[Rat GULO (Exon10)]

Below are four genetic sequences from primates with dysfunctional versions of that same gene:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC[Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC[Chimpanzee GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC[Orangutan GULOP (Exon10)]

AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC[Macaque GULOP (Exon10)]

Note the deletion (shown in red) shared among the various primates. If common ancestry is not the reason for these primates to share the same tell tale deletion then what is? Certainly a “designer” wouldn’t purposefully create these organisms with deletions. Why do we find them there?

How do you know it's a deletion?

 

[sfs]

It's a big deal because H. sapiens are unable to synthesize vitamin C, however, as you know, we get a horrible connective tissue disease if we don't eat citrus (vit. C).

All other primates have the gene that allows them to synthesize vitamin C. It is essentially a genetic mutation in the genome of H. sapiens that prevents us from synthesizing vit. C.

Basically, humans have the gene that codes for vit. C synthesis, but it's 'turned off.'

No, that's not it. All monkeys and apes (including humans) lack a functioning GULO gene, so none of us can synthesize vitamins C (and therefore get scurvy if we don't have vitamin C in our diet). The important point is that monkeys and apes have a copy of the GULO gene, but the copy is broken, and in all of them it's broken in exactly the same place, with the same piece missing. That common defect is a signature of common descent: we all have the same flaw in the gene because we all inherited it from a common ancestor, in whom the mutation occurred.

 

[sfs]

How do you know it's a deletion?

That's the most parsimonious explanation: a single deletion turned a functioning gene into junk. Can you think of another reason why a group of closely related organisms should have a nonfunctioning copy of the gene, while nearly all other animals have a functioning copy, and the functioning copy has a small piece of additional sequence needed to make it work?

 

[MarkT]

That's the most parsimonious explanation: a single deletion turned a functioning gene into junk. Can you think of another reason why a group of closely related organisms should have a nonfunctioning copy of the gene, while nearly all other animals have a functioning copy, and the functioning copy has a small piece of additional sequence needed to make it work?

How do you know they are related?

 

[sfs]

How do you know they are related?

I don't mean they have to be genetically related; I mean they have a close relationship with one another. Specifically, they're similar in terms of body structure and features, similar enough that they were classified as belonging to the same taxonomic type well before a genetic relationship was suggested. They're also similar to each other genetically.

My question still stands: can you think of another reason why they share the identical genetic defect (and it's awfully hard to call it anything other than a defect), besides having inherited it?

 

[MarkT]

I don't mean they have to be genetically related; I mean they have a close relationship with one another. Specifically, they're similar in terms of body structure and features, similar enough that they were classified as belonging to the same taxonomic type well before a genetic relationship was suggested. They're also similar to each other genetically.

My question still stands: can you think of another reason why they share the identical genetic defect (and it's awfully hard to call it anything other than a defect), besides having inherited it?

The same taxonomic type? How do you know they are related biologically speaking as opposed to being related taxonomically speaking?

 

[sfs]

The same taxonomic type? How do you know they are related biologically speaking as opposed to being related taxonomically speaking?

I don't, not when I ask the question about GULO. That's the whole point. You start with some observed physical similarities between a bunch of primates, similarities that form a tree-like structure. You formulate a hypothesis: maybe these species are similar because they descend from common ancestor. (Well, you formulate that hypothesis if you're Darwin, but that's beside the point.)

Then you ask what genetics can tell you to evaluate this hypothesis. And look -- here's a gene that has an important biological role, but is defective in all of these primates, and it's defective in precisely the same way in all of them. That's exactly the kind of thing that you would expect to see if they really did share descent from a common ancestor. but it's not the kind of thing you would expect if each species had been designed individually. That makes this observation evidence for common descent. So you ask the question, "Can you think of another reason why they share the identical genetic defect (and it's awfully hard to call it anything other than a defect), besides having inherited it?" and wait for someone to offer an alternative explanation. And wait, and wait . . .

 

[MarkT]

I don't, not when I ask the question about GULO. That's the whole point. You start with some observed physical similarities between a bunch of primates, similarities that form a tree-like structure. You formulate a hypothesis: maybe these species are similar because they descend from common ancestor. (Well, you formulate that hypothesis if you're Darwin, but that's beside the point.)

Then you ask what genetics can tell you to evaluate this hypothesis. And look -- here's a gene that has an important biological role, but is defective in all of these primates, and it's defective in precisely the same way in all of them. That's exactly the kind of thing that you would expect to see if they really did share descent from a common ancestor. but it's not the kind of thing you would expect if each species had been designed individually. That makes this observation evidence for common descent. So you ask the question, "Can you think of another reason why they share the identical genetic defect (and it's awfully hard to call it anything other than a defect), besides having inherited it?" and wait for someone to offer an alternative explanation. And wait, and wait . . .

How do you know they're deletions?

 

[sfs]

How do you know they're deletions?

I already answered that question (post #33, above). Why didn't you respond to my question there?

We know that most animals have a functioning GULO gene, and can therefore synthesize vitamin C. We know that a group of primates have a nonfunctioning GULO gene, and can therefore not synthesize vitamin C. We know that the common factor that distinguishes the functioning and nonfunctioning copies is a short piece of sequence that is present in the functioning copies and absent in the nonfunctioning copies. We know that pieces of genes are quite often deleted in reproduction. So common descent offers a simple explanation for the nonfunctioning genes, based on an mechanism: the ancestor of all of these primates suffered a deletion in that gene, and all descendent species have shared that deletion. If there were a competing explanation, we could weigh the two against one another and decide if one were more likely -- but there is no competing explanation. The usual creationist response to this case is to change the subject.

 

[MolecularGenetics]

MarkT, you asked, "how do you know [haplorrhines] are related," and, "how do you know [the polymorphism is] a deletion?" Well, let's look at all the data, without any presuppositions:

1. Not only do haplorrhines (a primate suborder) and guinea pigs have inactive copies of L-ascorbic acid-producing L-gulono-γ-lactone oxidase (well technically, it produces 2-keto-gulono-γ-lactone, witch spontaneously converts into L-ascorbic acid), but they also posses the genes for all the remaining enzymes in the metabolic pathway, such as UDP-glucose dehydrogenase (4p15.1) and glucuronic acid epimerase (15q23).
2. Haplorrhine GULO is inactive due to a missing base pair in the amino acid coding region of exon 10, which shifts its reading frame. This shift forms a stop codon that is is prior to that of active GULOs. Not only is this stop codon present, and is this base pair missing in all haplorrhine GULOPs, but it is not found in the guinea pig GULOP; which was inactivated by one its 3 stop codons in exons 2, 3, and 6.
3. There are many shared single nucleotide polymorphisms (SNPs) among haplorrhine GULOPs, but not with the guinea pig GULOP. And the shared haplorrhine SNPs fall in a hierarchical grouping, where each set falls within another set (a nested hierarchy).

Notice how I've intentionally worded this to make no assumptions about ancestry or mutation? So now let's look at the models of GULO deactivation and of common ancestry and see how well they fit the data:

1. If haplorrhines and guinea pigs once biosynthesized L-ascorbic acid, we should find the genes for the rest of the pathway. And we do.
2. Deactivation
   1. We should also find deactivating mutations in the GULOPs (which manifest themselves as deviation from active GULO sequences in other animals, such that the GULO enzyme is not expressed). And we do.
   2. If the deactivation occurred in an ancestor common to the haplorrhines, we should expect to find the same deactivating mutation in all haplorrhine GULOPs. And we do.
   3. Since there are many other species genetically closer to haplorrhines than guinea pigs, and since those species have active GULOs, the guinea pig GULOP deactivation should be lineage-specific; so we should expect to find its deactivating mutation in a different location. And we do.
3. Since deactivated genes (pseudogenes) accumulate mutations from generation to generation, and since the haplorrhine GULOP would have to have been in pseudogene form across many speciation events (and in turn, many common ancestors), we should find shared mutations (again, manifesting as shared SNPs), and we should find that they are arranged in such a way that they give an unbroken line of inheritance for every species (a nested hierarchy). And we do.

As you can see, the only model that parsimoniously fits all the data is that of common ancestry; where the shared SNPs are shared mutations.

Here are some publications on the topic (you can find them on PubMed):

Nishikimi, M., T. Kawai, and K. Yagi. "Guinea pigs possess a highly mutated gene for L-gulono-γ-lactone oxidase, the key enzyme for L-ascorbic acid biosynthesis missing in this species." Journal of Biological Chemistry 267.30 (1992): 21967-1972.

Ohta, Y., and M. Nishikimi. "Random nucleotide substitutions in primate nonfunctional gene for L-gulono-γ-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis." Biochimica et Biophysica Acta 1472.1-2 (1999): 408-11.


And if you can't access the publication by Ohta and Nishikimi to see the nested hierarchy, here's a phylogenetic tree I made with the NCBI's BLAST program, using nucleotide sequences of GULO/GULOP exon 10, and a multiple sequence alignment I made with the ClustalW2 program on the EMBL-EBI's website:

Just type in evolutionarymodel dot com slash GULOP_NH.jpg