GULO Pseudogene as evidence for common ancestry among primates

[AnEmpiricalAgnostic]

Here is a genetic sequence from an organism with a working GULO gene:

GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC
[Rat GULO (Exon10)]

Below are four genetic sequences from primates with dysfunctional versions of that same gene:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC[Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC[Chimpanzee GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC[Orangutan GULOP (Exon10)]

AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC[Macaque GULOP (Exon10)]

Note the deletion (shown in red) shared among the various primates. If common ancestry is not the reason for these primates to share the same tell tale deletion then what is? Certainly a “designer” wouldn’t purposefully create these organisms with deletions. Why do we find them there?

 

[MrGoodBytes]

LOL, I think that I am the one that is missing something. Because I fail to see how "glyphosate" resistant weeds is an arguement FOR evolution. I do not even know what glyphosate is so how can that be evidence for anything. Maybe for you it is evidence, for me it is just a word that I do not know the meaning of.

 

[I_Love_Cheese]

LOL, I think that I am the one that is missing something. Because I fail to see how "glyphosate" resistant weeds is an arguement FOR evolution. I do not even know what glyphosate is so how can that be evidence for anything. Maybe for you it is evidence, for me it is just a word that I do not know the meaning of.

Not sure what Glyphosate has to do with this thread but.

Glyphosate is the active ingredient in Roundup a broad spectrum plant killer. When it first came out there was no known resistance to it, there are now glyphosate resistant weeds and they have a different resistance than the plants that were genetically engineered to be resistant.

Sounds like evolution to me.

 

[I_Love_Cheese]

Here is a genetic sequence from an organism with a working GULO gene:

GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC
[Rat GULO (Exon10)]

Below are four genetic sequences from primates with dysfunctional versions of that same gene:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC[Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC[Chimpanzee GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC[Orangutan GULOP (Exon10)]

AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC[Macaque GULOP (Exon10)]

Note the deletion (shown in red) shared among the various primates. If common ancestry is not the reason for these primates to share the same tell tale deletion then what is? Certainly a “designer” wouldn’t purposefully create these organisms with deletions. Why do we find them there?

The designer was up to late and didn't notice that he had lost a punchcard for his program, with more modern computers he wouldn't have had to stay up so late to finish the primates.

 

[mark kennedy]

These sub-optimal arguments just kill me. Its a randomly occuring deletion and the human GULO has multiple mutations. We know why it doesn't work and why there is no selection on the gene.

You keep making the baseless assumption that they only way you could have the exact same mutation in the exact same gene is if it was inherited. It is absured for a number of reasons not the least of which is it's not a single nucleotide deletion. It is not a single exon that is disfunctional.

There really are some serious arguments in favor of common ancestry but this one is more like comedy relief.

 

[AnEmpiricalAgnostic]

Its a randomly occuring deletion and the human GULO has multiple mutations. We know why it doesn't work and why there is no selection on the gene.

The mutations are random and the GULOP has multiple mutations. This explains why they form a nested hierarchy when aligned. This DOES NOT explain why we would share this same deletion across the board. The fact that mutations are random is what makes the assertion of an identical deletion like this happening independently of inheritance from a common ancestor extraordinarily inane.

You keep making the baseless assumption that they only way you could have the exact same mutation in the exact same gene is if it was inherited.

But it’s not as simple as you’d like to characterize it is it? It’s the exact same deletion shared among multiple primates. Your “weak point” argument as to why this would happen is inadequate as is your assertion of random mutation for explaining it.

There really are some serious arguments in favor of common ancestry but this one is more like comedy relief.

The only thing comical here is watching you try to wiggle your way out of admitting that there is no better explanation for this evidence than common ancestry. Your “weak point” argument and assertion of random mutation pale in comparison to common ancestry in explanatory power and plausibility.

 

[Split Rock]

These sub-optimal arguments just kill me. Its a randomly occuring deletion and the human GULO has multiple mutations. We know why it doesn't work and why there is no selection on the gene.

This is not a "sub-optimal" argument at all. The question is why are these exact mutations in dead genes in all the genomes of different primates that creationists claim are not related by common ancestry.

You keep making the baseless assumption that they only way you could have the exact same mutation in the exact same gene is if it was inherited. It is absured for a number of reasons not the least of which is it's not a single nucleotide deletion. It is not a single exon that is disfunctional.

There is no assumption here. Why don't you answer the O.P.'s question with a better answer than common ancestry?

There really are some serious arguments in favor of common ancestry but this one is more like comedy relief.

There was nothing at all insulting or snide in the O.P. Why are you responding with an insulting, snide remark? Why don't you answer the question in the O.P. instead?

 

[shernren]

While we're at it, a close look reveals that even the single-base substitutions fall into a nested hierarchy. It was quite shocking, as I'd only set out to count the number of different nucleotides (and there is variation in about 19 nucleotides out of 162 including deleted nucleotide, or roughly 14%). I didn't expect single-base substitutions to form a nested hierarchy as these substitions are fairly common and so may occur independently in different lineages.

But the GULOP pseudogene allows a crude cladogram. No single-base substitution was found only in human and orangutan GULOP without being found in chimpanzee GULOP as well. Ditto chimp-macaque; in the one position where humans have a different nucleotide from everyone else, all the other three primates have identical nucleotides.

The problem is that I don't know how to draw a cladogram. Can anyone help?

 

[I_Love_Cheese]

While we're at it, a close look reveals that even the single-base substitutions fall into a nested hierarchy. It was quite shocking, as I'd only set out to count the number of different nucleotides (and there is variation in about 19 nucleotides out of 162 including deleted nucleotide, or roughly 14%). I didn't expect single-base substitutions to form a nested hierarchy as these substitions are fairly common and so may occur independently in different lineages.

But the GULOP pseudogene allows a crude cladogram. No single-base substitution was found only in human and orangutan GULOP without being found in chimpanzee GULOP as well. Ditto chimp-macaque; in the one position where humans have a different nucleotide from everyone else, all the other three primates have identical nucleotides.

The problem is that I don't know how to draw a cladogram. Can anyone help?

First a question, where did you find the info?

Second, here is a start, a lesson plan for high school lessons, the info is there, I think, for a basic cladogram, though it may take a while to read, but the site is interesting in and of itself.
root http://www.indiana.edu/~ensiweb/evol.fs.html
more specifics at

Lesson B: WHAT CAN PSEUDOGENES TELL US ABOUT COMMON ANCESTRY and more,

looks like you should be able to do a crude one with a spreadsheet and sort functions. If I can find the data, I may try it just for fun.

 

[Split Rock]

LOL, I think that I am the one that is missing something. Because I fail to see how "glyphosate" resistant weeds is an arguement FOR evolution. I do not even know what glyphosate is so how can that be evidence for anything. Maybe for you it is evidence, for me it is just a word that I do not know the meaning of.

The gene in question is involved in vitamin C synthesis and is inactive in primates. What does this have to do with glyphosate resistance in weeds???

 

[AnEmpiricalAgnostic]

First a question, where did you find the info?

I was able to find the sequences here. I bet once of the resident geneticists could provide a better link but at least the sequences are there to see.

 

[AnEmpiricalAgnostic]

Its a randomly occuring deletion…

You keep making the baseless assumption that they only way you could have the exact same mutation in the exact same gene is if it was inherited.

If you think you can get away with waving your hands and asserting that random mutations are the cause of the shared deletion you may want to take a look at what happens when we align the primate GULOPs with a working GULO gene:

GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC
AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC


It’s bad enough to try to explain away the deletion shared across the board with your weak random chance argument but try to wave off all these other shared mutations.

 

[I_Love_Cheese]

If you think you can get away with waving your hands and asserting that random mutations are the cause of the shared deletion you may want to take a look at what happens when we align the primate GULOPs with a working GULO gene:

GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC
AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC


It’s bad enough to try to explain away the deletion shared across the board with your weak random chance argument but try to wave off all these other shared mutations.

Hi AEA and thanks for the link, I just finished a first start, and came back to see your post, from what I just did, your above data set looks to be rat versus average or early primate with multiple copies of the latter.

Here is a base by base comp of the 5 sequences with my estimate as to where the deletion was (first guess worked out real well fortunately)

Very interesting, It is fairly obvious that chimps and humans are very close. Rats are quite different and the other two are in between with macaques farther from chimps/humans than gorillas.

The other thing about this is it is two plus hours of work, and gives a real appreciation for the work that went into it by the first people who did it.

Back to your data from this post, where did you get it, it is different than the earlier set?

edit two, just realized my graphic got cut short, the last 7 bases dont show, but agree with AEA's data.

Cheese

 

[shernren]

Brilliant AEA, that gave me an idea for how to show what I found ...

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC
AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC
AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC
GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC

Top-down: human, chimp, orangutan, macaque, rat

Orange - differences from the rat gene found in only one species.
Pink - differences from the rat gene found in two species.
Green - differences from the rat gene found in three species.
Red - differences from the rat gene found in all four species.

You want to look at the pink nucleotides - everywhere they are found, they are found in accordance with the nested hierarchy given by phylogenetics. We do not see any single-base substitutions that happened in macaques and chimps but not orangs and humans, or vice versa.

Even in such trivial and random mutations as single-base substitutions the independent nested hierarchy still holds. I'll be the first to tell you that I was surprised by that when I saw the differences yesterday, I was all ready to admit that the SBSs were just noise where the signal was the key single-nucleotide deletion. Turns out (to me at least) they weren't.

 

[AnEmpiricalAgnostic]

Back to your data from this post, where did you get it, it is different than the earlier set?

Sorry I wasn’t clear. The last post was the same data as before (rat, human, chimp, orang, macaque) from top to bottom. I just tightened it up to show all the mutations we share with other primates and how absurd it would be to try and claim it’s just happenstance and not common ancestry.

 

[Chalnoth]

We do not see any single-base substitutions that happened in macaques and chimps but not orangs and humans, or vice versa.

Actually, there do appear to be two that do just that. But this can be explained quite easily. First, look through all of the mutations. It is very obvious that, by far, the most common mutations are A<->G and C<->T., with the A<->G mutations themselves being more common than the C<->T mutations. Both of the single substitution mutations that appear to violate phylogeny are A<->G mutations, and so we naturally expect such coincidences to be much more common than coincidences with other types of mutations.

Anyway, what we have here are two mutations which appear to be coincidences, and 36 mutations that are consistent with the phylogenic tree. So even with the possibility of coincidence providing the possibility of false phylogeny, it's still exceedingly strong evidence for the existence of one true phylogenic tree.

 

[MrGoodBytes]

Not sure what Glyphosate has to do with this thread but.

Glyphosate is the active ingredient in Roundup a broad spectrum plant killer. When it first came out there was no known resistance to it, there are now glyphosate resistant weeds and they have a different resistance than the plants that were genetically engineered to be resistant.

Sounds like evolution to me.

I was trying to be funny and quoted a previous post by John, in anticipation to the creationist side's answers. Sorry for the derail.

 

[AnEmpiricalAgnostic]

Very interesting, It is fairly obvious that chimps and humans are very close. Rats are quite different and the other two are in between with macaques farther from chimps/humans than gorillas.

I was all ready to admit that the SBSs were just noise where the signal was the key single-nucleotide deletion. Turns out (to me at least) they weren't.

Nice work guys.

When I first started participating here on CF this was the one line of evidence I truly fell in love with. While there are many other lines of evidence this one is so straight forward and easy to understand I think it really drives the point home in a way almost everyone can grasp.

With just one simple comparison you can really see the shared genetics between humans and other primates while the fact that it&#8217;s a dysfunctional pseudogene takes away any possible argument of common design. It really leaves the creationist with no options but to dodge, make snide remarks, and run away.

I also like it because it really makes the creationists show their true stripes. The first time I saw this evidence presented I realized that creationists aren&#8217;t seeking truth after all. Even when they fully understand the evidence at hand they somehow block it out and hang all hope on the idea that these shared mutations happened coincidentally in independently created species rather than change their a priori beliefs.

 

[Split Rock]

I was trying to be funny and quoted a previous post by John, in anticipation to the creationist side's answers. Sorry for the derail.

Poe's Law strikes again!!

 

[MrGoodBytes]

Poe's Law strikes again!!

Recently, I came to the conclusion that maybe Poe's law is the best supported theory in science, not evolution.