The 'Macro-Micro' thing....again..

[Loudmouth]

Why am I getting hungry for a bowl of Alphabet soup?

DNA does have a sugar backbone.

 

[AV1611VET]

DNA does have a sugar backbone.

I'll take your word for it.

 

[HitchSlap]

I'll take your word for it.

What, no scripture?

I am so disappoint.

 

[createdtoworship]

I was reading an article at ICR and found this jem:

The British physicist, H.S. Lipson, has reached the following conclusion.

In fact, evolution became in a sense a scientific religion; almost all scientists have accepted it and many are prepared to 'bend' their observations to fit in with it. 8

8-8. H.S. Lipson, "A Physicist Looks at Evolution", Physics Bulletin (V. 31, n.d. 1980).

 

[Dizredux]

I was reading an article at ICR and found this jem:

The British physicist, H.S. Lipson, has reached the following conclusion.

In fact, evolution became in a sense a scientific religion; almost all scientists have accepted it and many are prepared to 'bend' their observations to fit in with it. 8

8-8. H.S. Lipson, "A Physicist Looks at Evolution", Physics Bulletin (V. 31, n.d. 1980).

But note that Lipson also said

Several people have given clear indications that they do not understand Darwin's theory. The Theory does not merely say that species have slowly evolved: that is obvious from the fossil record.

- H. J. Lipson, "A physicist looks at evolution - a rejoinder", Physics Bulletin, December 1980, pg 337.

It is clear that Lipson clearly accepts evolution and in fact states that it is obvious. Another quote mine from the ICR?


Dizredux



​

 

[createdtoworship]

The first problem is that ID supporters can't even show us how to measure it with respect to biology. For example, how much CSI does this DNA sequence have?

ACAGAAATCGTGTACCTACTAAATCTCTTTAATGTAAGTTCTGA
CTAATTCGTACTTTGTTAAGAACTTACATTTTAATAATAGAGGA
TATATGTTTTATTTTTATGATCTATTGATGTTCTTAAGGCTGCA
ATTTATATAATGAGGTAATATTTGCGGTAAGTCCTAGTGCAATG
GCAATTTTTTACTTTTGTTCTAAA

there is a lot of genetic code with little or no CSI, however it's the genetic code that HAS csi that is the key. The way you can tell, is that DNA cannot evolve by chance. It therefore has CSI to it because there is no other option. It can't have neither CSI nor evolutionary traits, it has one or the other. For example if you can somehow evolve a strand of DNA getting the proper types of nucleotides and linking them contrary to chemistry of water being soluble. Then even IF you had a code, you have no language to communicate WITH the DNA to utilize the building of proteins. In other words you need simultaneusly for a program engine to evolve at the same time. This itself is obsurdly possible by random chemistry. So please show how evolution has evolved DNA and utilized programs to build proteins from scratch with no bioavailable matter to begin with.

We can get pretty deep into this if you wish I was summing it up basically.

protein and DNA have CSI by default.

call it a argument from ignorance, or God of the Gaps but I can call your pseudo science the same thing.

evolution has no means of chemically creating DNA .

if you want to look,

check out wikipedia on chemical evolution versus biological evolution.

they are both evolution.

 

[createdtoworship]

As best I can tell CSI has not held up very well to testing. For example, can it detect design on an artificial bridge and not on a natural one accurately and consistently?

Now that is a mind boggling statement which demonstrates on several levels almost a complete lack of understanding of how evolution works.

What some have proposed and I think it is accurate is that we cannot detect design but instead detect signs of manufacture and from that infer design. I think this would also apply to Mt. Rushmore.

While it is my religious belief that the universe is designed, I think that the ID idea as presented by the Discovery Institute just doesn't hold water. As we say in Texas, that dog just won't hunt.

Dizredux

again CSI is the default here, if you can prove a bridge that was engineered and designed evolved from granite and gravel, then go ahead. Until then I seek the only other alternative which is the competing CSI theories.

 

[createdtoworship]

You ignored the real fossils, too.

This a cast of the real fossil:

Is the ilium on the side, like it is in humans, or in the back, like it is in chimps?



If all Lucy's features were exactly like humans, Lucy would be a human and not a transitional.

Can you please tell me why having ape-like features disqualifies Lucy as being transitional? Shouldn't we see ape-like features in a transitional?



And now you are playing the semantic games. Whether or not Lucy was a good biped, a bad biped, or an occasional biped does not disqualify Lucy as being a transitional. What Lucy undeniably has is a pelvis that is more like humans than it is other apes. That is what makes Lucy TRANSITIONAL, even if Lucy was not an obligate, walking on two legs 100% of the time, biped.

I like all the plaster of paris guess work. Do you have a complete fossil of either lucies hip, knee, ankle or feet?

Until then you don't really know how it walked do you?

 

[createdtoworship]

Those sketches are for simplicity, I showed you a picture of the skeleton.

he keys to bipedalism are in the knee, and ankle and feet as well as the hip. It's conveniently missing in all the photographs,

I wonder why?

(conspiracy theories abound)

 

[createdtoworship]

What about it? Is it towards the dorsal surface like that seen in other apes? Nope. Is it at the sides, as seen in the human pelvis? Yep, sure is.

look at how there is an angle in the area where the femur and leg bones meet up with the hip joint. Now look at the chimpanzees, and see how there is an angle there as well. It's obviously more chimpanzee than human as it relates to hanging a hip on leg bones for a full time occupation.

 

[Dizredux]

again CSI is the default here,
if you can prove a bridge that was engineered and designed evolved from granite and gravel, then go ahead. Until then I seek the only other alternative which is the competing CSI theories.

I don't understand the point of a bridge evolving. That doesn't even make nonsense.

What CSI has been challenged to do, and it is a necessity, is to show how it can differentiate designed from not designed. So far, I don't believe CSI can do this with any degree of accuracy.

Again about the best we can do right now is to see if something shows signs of manufacture. Take a rock that has a sharp edge (a scraper blade for example). Is this something that has formed from natural causes or something that shows signs of manufacture, deliberate changing of the shape. From those signs of manufacture we, with some degree of reliability, can infer design.

I really think that the idea of inferring design from manufacture is a more productive path than trying to figure out how to detect design by itself. Can you take the rock example and show how CSI can be applied? An expert can, for the most part, tell if a rock has been deliberately altered thus manufactured. People have spent their lives studying stone tools and they are pretty good at it and it is something we have the ability do do right now.

Again it would be nice if we could detect design but right now, we appear not to have the tools.

Dizredux

 

[createdtoworship]

I don't understand the point of a bridge evolving. That doesn't even make nonsense.

What CSI has been challenged to do, and it is a necessity, is to show how it can differentiate designed from not designed. So far, I don't believe CSI can do this with any degree of accuracy.

Again about the best we can do right now is to see if something shows signs of manufacture. Take a rock that has a sharp edge (a scraper blade for example). Is this something that has formed from natural causes or something that shows signs of manufacture, deliberate changing of the shape. From those signs of manufacture we, with some degree of reliability, can infer design.

I really think that the idea of inferring design from manufacture is a more productive path than trying to figure out how to detect design by itself. Can you take the rock example and show how CSI can be applied? An expert can, for the most part, tell if a rock has been deliberately altered thus manufactured. People have spent their lives studying stone tools and they are pretty good at it and it is something we have the ability do do right now.

Again it would be nice if we could detect design but right now, we appear not to have the tools.

Dizredux

okay thanks for the comment, let me illustrate with a few questions:

you said for example

the best we can do right now is to see if something shows signs of manufacture

and how would that be done without logical interaction of the evidences and a noticing of the complex, specific, information available?

if it were not complex it could have happened by accident

if it were not specific and detail oriented, again it could have happened by chance

if all this was not informative to our rational minds, then again we would not see that this was in fact machined.

 

[createdtoworship]

I was reading an article at ICR and found this jem:

The British physicist, H.S. Lipson, has reached the following conclusion.

In fact, evolution became in a sense a scientific religion; almost all scientists have accepted it and many are prepared to 'bend' their observations to fit in with it. 8

8-8. H.S. Lipson, "A Physicist Looks at Evolution", Physics Bulletin (V. 31, n.d. 1980).

here are some more quotes:

a little out dates but still priceless:

Evolution itself is accepted by zoologists not because it has
been observed to occur or is supported by logically coherent
arguments, but because it does fit all the facts of taxonomy,
of paleontology, and of geographical distribution, and because no
alternative explanation is credible.[7]

D.M.S. Watson, "Adaptation," Nature, Vol. 124, 10 August 1929, p. 231

"evolution itself, a theory universally accepted not because it can
be proved by logically coherent evidence to be true, but because the
only alternative, special creation, is clearly incredible[8]"

D.M.S. Watson, "Adaptation," Nature, Vol. 124, 10 August 1929, p. 233.

 

[CabVet]

here are some more quotes:

a little out dates but still priceless:

Evolution itself is accepted by zoologists not because it has
been observed to occur or is supported by logically coherent
arguments, but because it does fit all the facts of taxonomy,
of paleontology, and of geographical distribution, and because no
alternative explanation is credible.[7]

D.M.S. Watson, "Adaptation," Nature, Vol. 124, 10 August 1929, p. 231

"evolution itself, a theory universally accepted not because it can
be proved by logically coherent evidence to be true, but because the
only alternative, special creation, is clearly incredible[8]"

D.M.S. Watson, "Adaptation," Nature, Vol. 124, 10 August 1929, p. 233.

1929, really? Quote mines from 1929? Really? Of course evolution wasn't observed in 1929, people didn't even know what DNA was back in 1929. Today, there are several observed instances of evolution.

Here is a hint, if you go back to 1829 there will be no mention of evolution at all.

 

[Dizredux]

okay thanks for the comment, let me illustrate with a few questions:

you said for example

and how would that be done without logical interaction of the evidences and a noticing of the complex, specific, information available?

if it were not complex it could have happened by accident

if it were not specific and detail oriented, again it could have happened by chance

if all this was not informative to our rational minds, then again we would not see that this was in fact machined.

OK so how does this apply so we can see if something is designed or not in a repeatable fashion? How do you measure complex, and information in a way we can determine if what we have is more or less complex and contains more or less information? In other words, what are the metrics involved? I don't think Dembski has explained this by the reports I have read nor come up with a method that works very well.

Dizredux

 

[createdtoworship]

1929, really? Quote mines from 1929? Really? Of course evolution wasn't observed in 1929, people didn't even know what DNA was back in 1929. Today, there are several observed instances of evolution.

ah another railing accusation, please prove your assertions.

Also give me one transition that proves macro evolution

then we can call it a scientific theory.

but until it is observed (evolution between genus), it cannot be hypothesized about,

until it is has a hypothesis,

it can't be tested for such,

until it is tested it cannot be a scientific theory,

"getting lucky is not a scientific hypothesis" - William demski
from:
Evolution, Theistic Evolution, and Intelligent Design Article free online:

http://designinference.com/wp-content/uploads/2012/09/2010.02.25_Dembski_ID-Theo-Evo.pdf

 

[CabVet]

give me one transition that proves macro evolution, observed, tested, and hypothesized about.

Here: FOSSILS. Actual physical evidence.

 

[Dizredux]

here are some more quotes:

a little out dates but still priceless:

Evolution itself is accepted by zoologists not because it has
been observed to occur or is supported by logically coherent
arguments, but because it does fit all the facts of taxonomy,
of paleontology, and of geographical distribution, and because no
alternative explanation is credible.[7]

D.M.S. Watson, "Adaptation," Nature, Vol. 124, 10 August 1929, p. 231

"evolution itself, a theory universally accepted not because it can
be proved by logically coherent evidence to be true, but because the
only alternative, special creation, is clearly incredible[8]"

D.M.S. Watson, "Adaptation," Nature, Vol. 124, 10 August 1929, p. 233.

1929? Giveth me a break.That is some big time reaching.

Dizredux

 

[bhsmte]

1929? Giveth me a break.That is some big time reaching.

Dizredux

Grady has shown to have a long wingspan.

 

[CabVet]

1929? Giveth me a break.That is some big time reaching.

Dizredux

Well, that just proves that you have to go back almost 100 years in the scientific literature to find someone saying that evolution has not been observed.