The 'Macro-Micro' thing....again..

[createdtoworship]

pretty much all contingent on irreducible complexity, which hasn't been adequately demonstrated.

irreducible complexity is a thing of the past, it's now adapted to be called "specified complexity." For example evolution cannot adequately explain mount Rushmore. Because of the obvious inference of design. You wouldn't carbon date it or use radio isotope dating to find out the dates of the rocks in order to understand how the faces were formed or the dates of the erosions occuring. No, you would know it was designed and shaped, because of the levels of complex and specified information in has (CSI).

there are more to it in the link as far as how the scientific method applies to ID.

 

[Loudmouth]

easy this link provides some easy observations, tests, hypothesis, and scientific methodology for ID.....

Then it should be easy for you to describe them in your own words.

however Evolution is not so lucky, as there are no observations for it.

I already showed you the observations.

note ID is different than creationism,

The only difference is the spelling.

 

[PsychoSarah]

irreducible complexity is a thing of the past, it's now adapted to be called "specified complexity." For example evolution cannot adequately explain mount Rushmore. Because of the obvious inference of design. You wouldn't carbon date it or use radio isotope dating to find out the dates of the rocks in order to understand how the faces were formed or the dates of the erosions occuring. No, you would know it was designed and shaped, because of the levels of complex and specified information in has (CSI).

there are more to it in the link as far as how the scientific method applies to ID.

We also have video and documentation of that being man made; show me a rock formation that looks that much like people that is stated to be natural.

 

[Loudmouth]

irreducible complexity is a thing of the past, it's now adapted to be called "specified complexity." For example evolution cannot adequately explain mount Rushmore. Because of the obvious inference of design. You wouldn't carbon date it or use radio isotope dating to find out the dates of the rocks in order to understand how the faces were formed or the dates of the erosions occuring. No, you would know it was designed and shaped, because of the levels of complex and specified information in has (CSI).

Mt. Rushmore doesn't reproduce, and Mt. Rushmore does not fall into a nested hierarchy with other reproducing mountain sized statues.

You have a failed analogy. Even more, you haven't shown how CSI is calculated for Mt. Rushmore.

 

[createdtoworship]

What about it? Is it towards the dorsal surface like that seen in other apes? Nope. Is it at the sides, as seen in the human pelvis? Yep, sure is.

no photographs huh, only someone's hand sketches?

I can do that on a note pad.

Regarding Lucy-Lucy is actually a male, and was missing the toes and fingers. But others have been found from this species with feet intact and I can attest that these bones (rarely photographed) have been studied and tested by various sources that they are in fact "ape like" and are arboreal in nature and not flat footed like humans.

also from another link:

"The bipedal question, of course, is not whether proposed hominid ancestors were able to walk upright—any chimp today can do that after a fashion for brief periods—but whether bipedal locomotion was the normal and efficient way of getting around. From the evolutionary point of view, evolving hominids needed to free their hands for other uses. A hominid that spent a good deal of time knuckle-walking would therefore fail as a convincing candidate for human ancestor. Oddly enough, though, some of the most convincing evidence against Lucy’s proposed bipedalism comes not from her lower extremities but from her wrists. Evolutionists Brian Richmond and David Strait compared the skeletal morphology of living knuckle-walking primates to the bones of Australopithecus afarensis. Lucy’s bones show the features used to lock the wrist for secure knuckle-walking seen in modern knuckle-walkers.
In addition to wrists designed for knuckle-walking, Richmond and Strait noted that Lucy also had neck, shoulder, arm, finger, and toe anatomy suited to arboreal life. "
above excerpt from:
A Look at Lucy’s Legacy - Answers in Genesis

basically to sum it up, if the wrists are suited for knucklewalking it most likely did not even use the legs in a biped way. Due to the fact that the wrists are curled under.

 

[PsychoSarah]

no photographs huh, only someone's hand sketches?

I can do that on a note pad.

Regarding Lucy-Lucy is actually a male, and was missing the toes and fingers. But others have been found from this species with feet intact and I can attest that these bones (rarely photographed) have been studied and tested by various sources that they are in fact "ape like" and are arboreal in nature and not flat footed like humans.

also from another link:

"The bipedal question, of course, is not whether proposed hominid ancestors were able to walk upright—any chimp today can do that after a fashion for brief periods—but whether bipedal locomotion was the normal and efficient way of getting around. From the evolutionary point of view, evolving hominids needed to free their hands for other uses. A hominid that spent a good deal of time knuckle-walking would therefore fail as a convincing candidate for human ancestor. Oddly enough, though, some of the most convincing evidence against Lucy’s proposed bipedalism comes not from her lower extremities but from her wrists. Evolutionists Brian Richmond and David Strait compared the skeletal morphology of living knuckle-walking primates to the bones of Australopithecus afarensis. Lucy’s bones show the features used to lock the wrist for secure knuckle-walking seen in modern knuckle-walkers.
In addition to wrists designed for knuckle-walking, Richmond and Strait noted that Lucy also had neck, shoulder, arm, finger, and toe anatomy suited to arboreal life. "
above excerpt from:
A Look at Lucy’s Legacy - Answers in Genesis

Those sketches are for simplicity, I showed you a picture of the skeleton.

 

[Loudmouth]

no photographs huh, only someone's hand sketches?

You ignored the real fossils, too.

This a cast of the real fossil:

Is the ilium on the side, like it is in humans, or in the back, like it is in chimps?

Regarding Lucy-Lucy is actually a male, and was missing the toes and fingers. But others have been found from this species with feet intact and I can attest that these bones (rarely photographed) have been studied and tested by various sources that they are in fact "ape like" and are arboreal in nature and not flat footed like humans.

If all Lucy's features were exactly like humans, Lucy would be a human and not a transitional.

Can you please tell me why having ape-like features disqualifies Lucy as being transitional? Shouldn't we see ape-like features in a transitional?

also from another link:

"The bipedal question, of course, is not whether proposed hominid ancestors were able to walk upright—any chimp today can do that after a fashion for brief periods—but whether bipedal locomotion was the normal and efficient way of getting around. From the evolutionary point of view, evolving hominids needed to free their hands for other uses. A hominid that spent a good deal of time knuckle-walking would therefore fail as a convincing candidate for human ancestor. Oddly enough, though, some of the most convincing evidence against Lucy’s proposed bipedalism comes not from her lower extremities but from her wrists. Evolutionists Brian Richmond and David Strait compared the skeletal morphology of living knuckle-walking primates to the bones of Australopithecus afarensis. Lucy’s bones show the features used to lock the wrist for secure knuckle-walking seen in modern knuckle-walkers.
In addition to wrists designed for knuckle-walking, Richmond and Strait noted that Lucy also had neck, shoulder, arm, finger, and toe anatomy suited to arboreal life. "
above excerpt from:
A Look at Lucy’s Legacy - Answers in Genesis

And now you are playing the semantic games. Whether or not Lucy was a good biped, a bad biped, or an occasional biped does not disqualify Lucy as being a transitional. What Lucy undeniably has is a pelvis that is more like humans than it is other apes. That is what makes Lucy TRANSITIONAL, even if Lucy was not an obligate, walking on two legs 100% of the time, biped.

 

[AV1611VET]

This a cast of the real fossil:

Don't these pictures violate HIPAA laws or something?

 

[PsychoSarah]

Don't these pictures violate HIPAA laws or something?

*shoulder shrug*

 

[AV1611VET]

*shoulder shrug*

Paleoarchaeolograverobbers like to dig peoples' bones up all the time and put them on display ... including talking about their medical problems.

You'd think it would violate HIPAA.

 

[Loudmouth]

Don't these pictures violate HIPAA laws or something?

Nope. No personal identifiers are being used.

 

[PsychoSarah]

Paleoarchaeolograverobbers like to dig peoples' bones up all the time and put them on display ... including talking about their medical problems.

You'd think it would violate HIPAA.

Well, do you find displaying deer antlers to be a violation of HIPAA? I mean, Lucy may be a transition creature, but it isn't human.

 

[Loudmouth]

Paleoarchaeolograverobbers like to dig peoples' bones up all the time and put them on display ... including talking about their medical problems.

You'd think it would violate HIPAA.

In case you were curious . . .

"The HIPAA Privacy Rule protects the individually identifiable health information about a decedent for 50 years following the date of death of the individual."
Health Information of Deceased Individuals

That is straight from the US Department of Health and Human Services.

 

[Dizredux]

irreducible complexity is a thing of the past, it's now adapted to be called "specified complexity."

As best I can tell CSI has not held up very well to testing. For example, can it detect design on an artificial bridge and not on a natural one accurately and consistently?

For example evolution cannot adequately explain mount Rushmore.

Now that is a mind boggling statement which demonstrates on several levels almost a complete lack of understanding of how evolution works.

Because of the obvious inference of design. You wouldn't carbon date it or use radio isotope dating to find out the dates of the rocks in order to understand how the faces were formed or the dates of the erosions occurring. No, you would know it was designed and shaped, because of the levels of complex and specified information in has (CSI).

there are more to it in the link as far as how the scientific method applies to ID.

What some have proposed and I think it is accurate is that we cannot detect design but instead detect signs of manufacture and from that infer design. I think this would also apply to Mt. Rushmore.

While it is my religious belief that the universe is designed, I think that the ID idea as presented by the Discovery Institute just doesn't hold water. As we say in Texas, that dog just won't hunt.

Dizredux

 

[HitchSlap]

Don't these pictures violate HIPAA laws or something?

Why, is she a US citizen?

 

[AV1611VET]

Nope. No personal identifiers are being used.

Hmmm ... good point!

 

[AV1611VET]

In case you were curious . . .

"The HIPAA Privacy Rule protects the individually identifiable health information about a decedent for 50 years following the date of death of the individual."
Health Information of Deceased Individuals

That is straight from the US Department of Health and Human Services.

Wow ... I didn't know that! Thanks again for the 411.

 

[AV1611VET]

Why, is she a US citizen?

Okay ... points taken.

Let's move on.

 

[Loudmouth]

As best I can tell CSI has not held up very well to testing. For example, can it detect design on an artificial bridge and not on a natural one accurately and consistently?

The first problem is that ID supporters can't even show us how to measure it with respect to biology. For example, how much CSI does this DNA sequence have?

ACAGAAATCGTGTACCTACTAAATCTCTTTAATGTAAGTTCTGA
CTAATTCGTACTTTGTTAAGAACTTACATTTTAATAATAGAGGA
TATATGTTTTATTTTTATGATCTATTGATGTTCTTAAGGCTGCA
ATTTATATAATGAGGTAATATTTGCGGTAAGTCCTAGTGCAATG
GCAATTTTTTACTTTTGTTCTAAA

 

[AV1611VET]

The first problem is that ID supporters can't even show us how to measure it with respect to biology. For example, how much CSI does this DNA sequence have?

ACAGAAATCGTGTACCTACTAAATCTCTTTAATGTAAGTTCTGA
CTAATTCGTACTTTGTTAAGAACTTACATTTTAATAATAGAGGA
TATATGTTTTATTTTTATGATCTATTGATGTTCTTAAGGCTGCA
ATTTATATAATGAGGTAATATTTGCGGTAAGTCCTAGTGCAATG
GCAATTTTTTACTTTTGTTCTAAA

Why am I getting hungry for a bowl of Alphabet soup?