Some Reasons I Don't Believe in Evolution

[SkyWriting]

Yes, and this is also perfectly compatible with the modern concept of "common ancestry," in that our Creator and designer imbedded His own image and likeness into all of Creation, all as varying means of revealing Himself.

Even the heavens declare the Glory of G-d, and on the other end of the spectrum so do the tiniest particles.

Maybe so. But there is nothing in what Jesus said and how he acted to even HINT at common ancestry. He spoke of the father knowing when a sparrow fell, but had no comment on us honoring the sparrow. Or dirt, or anything of this world. He actually said this world was to be burned up.

Jesus gave not much thanks to our ancestor worms & grubs. I'll bet Darwin would consider Jesus to be ungrateful to our Slime-dads.

 

[SkyWriting]

why even discuss science with people who don't understand it?

Tell them to go school, or read a book. Why waste your time with people who simply want to refuse to acknowledge the facts because they've been mislead with falsehoods their whole lives?

Oh...it's not all that fancy hard as you worship it to be:

I'm tired of hearing how HARD this science is ..it's goin in my sig file.

Define a question
Gather information and resources (observe)
Form an explanatory hypothesis
Test the hypothesis by performing an experiment and collecting data in a reproducible manner
Analyze the data
Interpret the data and draw conclusions that serve as a starting point for new hypothesis
Publish results
Retest (frequently done by other scientists)

 

[mpok1519]

Oh...it's not all that fancy hard as you worship it to be:

I'm tired of hearing how HARD this science is ..it's goin in my sig file.

Define a question
Gather information and resources (observe)
Form an explanatory hypothesis
Test the hypothesis by performing an experiment and collecting data in a reproducible manner
Analyze the data
Interpret the data and draw conclusions that serve as a starting point for new hypothesis
Publish results
Retest (frequently done by other scientists)

and who the heck said I worship science pal?

 

[cupid dave]

Zaius137
[“If DNA is non functional, evolution is not likely to preserve it, yes. Although it can be fixed by genetic drift. This explains, btw, why there is so much variation between species in non-coding reagions of DNA.”

I think the evolutionist must answer that one. Because as a Creationist I believe the information originated by intelligence and the Bible strictly states “each after its own kind”


Split Rock:
And no biologist would say diffferently. Our ancestors were eukaryotes, animals, vertebrates, tetrapods, mammals, primates, and apes... just like us. As I like to say, you cannot escape your heredity. However, this does not preclude descent with modification.

What I read in Gen 5:2 supports that the word "Adam" refers to a species or kind, but definitely not to an individual:


Genesis 5:2 Male and female created he THEM; and blessed THEM, and called THEIR name Adam, (a species), in the day when THEY were created.

 

[SkyWriting]

and who the heck said I worship science pal?

I think that was me.

 

[SkyWriting]

What I read in Gen 5:2 supports that the word "Adam" refers to a species or kind, but definitely not to an individual:


Genesis 5:2 Male and female created he THEM; and blessed THEM, and called THEIR name Adam, (a species), in the day when THEY were created.

I've never noticed that. That is how it reads.
Genesis 5:2 He created them male and female and blessed them. And when they were created, he called them "man."

 

[Split Rock]

Please tell us which carries more information:

AGAGTTAATTTTC
CATCTGGTGACCA

So here is a DNA sequence:

ATCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGCAGACATTATA

What does this sequence look like when it A) gains information, and B) loses information.

Funny how creationists come here and tell us about "well founded" Information Theory that shows evolution can't add information, but then cannot answer a simple practical question about information.

 

[driewerf]

Well here's the stickler for me? Why are any apes even left if we evolved from apes? Was there a "pause" in the evolution process? A flaw? Were some apes just stubborn and ran from it, time-traveled from it? Please explain. Anyone. Thank you kindly.

If all the Afro Americans descenc from Africans,, why are there still Africans?
If all caucasian Americans descend from Europeans, why are there still Europeans?
If all Asian Americans descend from Asians, why are there still Asians?

Were some Africans/Europeans/ Asians just stubborn and ran from it, time-traveled from it? Please explain. Anyone. Thank you kindly.

Hmmm.....yet, all mentioned are human beings....not following you...

I want to appologise for my late respons. But I think this deserves an answer. As you were triomphantly announcing you think that the fact that there still are apes (though you mean monkeys) disproves evolution.

Judging by you answer you missed my point entirely. So I ask you to answer my question as good as you can:

If all caucasian Americans descend from Europeans, why are there still Europeans?

 

[cupid dave]

quote=driewerf;58854564]

If all the Afro Americans descenc from Africans,, why are there still Africans?
If all caucasian Americans descend from Europeans, why are there still Europeans?
If all Asian Americans descend from Asians, why are there still Asians?

Were some Africans/Europeans/ Asians just stubborn and ran from it, time-traveled from it? Please explain. Anyone. Thank you kindly.

I want to appologise for my late respons. But I think this deserves an answer. As you were triomphantly announcing you think that the fact that there still are apes (though you mean monkeys) disproves evolution.

Judging by you answer you missed my point entirely. So I ask you to answer my question as good as you can:[/QUOTE]


I don't understand why the bible people ignore that science supports Genesis in so many ways, especially in this case of species preceding the advent of Modern man.

The 22 "begats" are clearly analogous to the 22 extinct species as enumerated in the latest book on the subject:


The Last Human: A Guide to Twenty-Two (22) Species of Extinct Humans
by G.J. Sawyer, Viktor Deak
Hardcover, 256 pages
Published June 28th 2007 by Yale University Press

 

[Huram Abi]

That book is outdated.

There are more than 22 species discovered.

Try again.

 

[cupid dave]

That book is outdated.

There are more than 22 species discovered.

Try again.

Name them...

The paleontologists haven't really got their story straight yet, because they have removed some species since June 2007 and found one or two candidates to add.

But they are hitting around 22 with the adds and subtracts anyway.

 

[Huram Abi]

Ahahahahahaha!!!!

Not that I accept your claim, but consider this: you are relying on a book that has species in it that you now claim have been removed. You've just debunked the very book you are trying to use as evidence! Hilarious!

Here are 25 human species for you:

Sahelanthropus tchadensis

Orrorin tugenensis

Australopithecus anamensis

Ardipithecus ramidus

Australopithecus afarensis

Kenyanthropus platyops

Australopithecus bahrelghazali

Australopithecus africanus

Paranthropus aethiopicus

Homo erectus

Paranthropus robustus

Australopithecus sediba

Homo habilis

Homo rudolfensis

Paranthropus boisei

Homo georgicus

Homo ergaster

Homo gautengensis

Homo antecessor

Homo heidelbergensis

Homo neanderthalensis

Homo rhodesiensis

Homo sapiens

Homo floresiensis

Homo sapiens idaltu


Now, it is your turn: List the 22 begats in the bible that are supposed to be analogous to the species in your outdated book.

Also, give a clear and reasonable explanation on what differentiates the geneological list at the 23rd begat that signifies that this is the point that the bible stops talking about species and begins a generational lineage.

Good luck!

 

[Skaloop]

Ahahahahahaha!!!!

Not that I accept your claim, but consider this: you are relying on a book that has species in it that you now claim have been removed. You've just debunked the very book you are trying to use as evidence! Hilarious!

Here are 25 human species for you:

Sahelanthropus tchadensis

Orrorin tugenensis

Australopithecus anamensis

Ardipithecus ramidus

Australopithecus afarensis

Kenyanthropus platyops

Australopithecus bahrelghazali

Australopithecus africanus

Paranthropus aethiopicus

Homo erectus

Paranthropus robustus

Australopithecus sediba

Homo habilis

Homo rudolfensis

Paranthropus boisei

Homo georgicus

Homo ergaster

Homo gautengensis

Homo antecessor

Homo heidelbergensis

Homo neanderthalensis

Homo rhodesiensis

Homo sapiens

Homo floresiensis

Homo sapiens idaltu


Now, it is your turn: List the 22 begats in the bible that are supposed to be analogous to the species in your outdated book.

Also, give a clear and reasonable explanation on what differentiates the geneological list at the 23rd begat that signifies that this is the point that the bible stops talking about species and begins a generational lineage.

Good luck!

You forgot (or missed) Australopithecus garhi. That one holds a dear place in my heart as I have a tattoo of its skull...

 

[cupid dave]

Ahahahahahaha!!!!

Not that I accept your claim, but consider this: you are relying on a book that has species in it that you now claim have been removed. You've just debunked the very book you are trying to use as evidence! Hilarious!

Here are 25 human species for you:

Sahelanthropus tchadensis

Orrorin tugenensis

Australopithecus anamensis

Ardipithecus ramidus

Australopithecus afarensis

Kenyanthropus platyops

Australopithecus bahrelghazali

Australopithecus africanus

Paranthropus aethiopicus

Homo erectus

Paranthropus robustus

Australopithecus sediba

Homo habilis

Homo rudolfensis

Paranthropus boisei

Homo georgicus

Homo ergaster

Homo gautengensis

Homo antecessor

Homo heidelbergensis

Homo neanderthalensis

Homo rhodesiensis

Homo sapiens

Homo floresiensis

Homo sapiens idaltu


Now, it is your turn: List the 22 begats in the bible that are supposed to be analogous to the species in your outdated book.

Also, give a clear and reasonable explanation on what differentiates the geneological list at the 23rd begat that signifies that this is the point that the bible stops talking about species and begins a generational lineage.

Good luck!

You have to scrap Homo_floresiensis.

Homo sapiens idaltu = Early Homo sapiens, or Noah.

 

[Huram Abi]

Idultu is a sub species

and, no, I don't have to scrap floresiensis. It's even in the Homo genus. It's not just a hominid, but a humanoid species.

And I also left out Denisova hominin so along with Australopithecus garhi, that makes 27 species.

 

[Huram Abi]

And Noah is the 9th begat, not the 22nd.

 

[razeontherock]

You forgot (or missed) Australopithecus garhi. That one holds a dear place in my heart as I have a tattoo of its skull...

Wait, all the grey parts were never found, and the tan parts were bone fragments they found, broken as indicated? And you place such confidence in this that you get a tattoo of it?

You have far greater Faith than I ever will

 

[SkyWriting]

Funny how creationists come here and tell us about "well founded" Information Theory that shows evolution can't add information, but then cannot answer a simple practical question about information.

argumentum ad hominem

I guess the appropriate response would be to show them wrong and provide the ability to check the work done. (See below)

 

[cupid dave]

Idultu is a sub species

and, no, I don't have to scrap floresiensis. It's even in the Homo genus. It's not just a hominid, but a humanoid species.

And I also left out Denisova hominin so along with Australopithecus garhi, that makes 27 species.

1) WRONG about Flores...

The University of Western Australia's Emeritus Professor Charles Oxnard and his colleagues, in a paper in PLoS ONE[bless and do not curse]have reconfirmed, on the post-cranial skeleton, their original finding on the skull that[bless and do not curse]Homo floresiensis[bless and do not curse]in fact bears the hallmarks of humans --[bless and do not curse]Homo sapiens[bless and do not curse]-- affected by hypothyroid cretinism.

HeritageDaily - The Latest Archaeology News & Articles - Homo floresiensis a new species of human?


2) Yeah, the scientists are still sorting stuff out.
They are way way behind God who said 22 in 1362AD at least.

For instance,...

Most of the paleoanthropologists accept that these fossils do not belong to a distinct species, but that the creature called Homo rudolfensis is in fact indistinguishable from Homo habilis.

3) The point remains that scientists do not have 35 nor 10, but right around these 22 found in Genesis.

AND... most paleontologists agree with those who wrote the newest book on the subject,... 22 extinct species.

Your criticism is getting more lame as we go along.
Why not join me and take a positive view instead of this nonsense???

 

[SkyWriting]

If all the Afro Americans descenc from Africans,, why are there still Africans?
If all caucasian Americans descend from Europeans, why are there still Europeans?If all Asian Americans descend from Asians, why are there still Asians?Were some Africans/Europeans/ Asians just stubborn and ran from it, time-traveled from it? Please explain. Anyone. Thank you kindly.

I believe 99% of common decent is rubbish. But if a species branched off to fill some niche, there is no reason the original ancestor can't remain in it's ecological niche and stay there and survive. Evolution isn't some outside force that causes an entire species to change in unison over some preset length of time. If only one part of a species population is pressured by it's environment, only that segment needs to branch off.

According to TV, time travel just consumes too much energy to be of value.