Some Reasons I Don't Believe in Evolution

[Huram Abi]

?

Old paradigms die hard.
The Fundamentalist christians on the one side, and the psuedo-science literati on the other, tend to hold on to what they repeat from the last generation in spite of the evidence I show you here.

Genesis cleasrly see these 22 links oin the ascent of modern man as species because Gen 5:2 says so:



Genesis 5:2Male and female created he THEM; and blessed THEM, and called THEIR name Adam, (a species or kind) in the day when THEY were created.

It's not a paradigm. It's called "following the evidence."

You haven't shown evidence. You have made claims. There is a huge difference.

Genesis doesn't have 22 links that signify species variation. It is a list of fathers and sons that includes much more than 22 sets. Besides that, it doesn't line up with the number of species of hominids discovered anyway. We're at 23 now, and in a few years we may be at 24 or 25.

Numerology is not your friend.

 

[Huram Abi]

The Last Human: A Guide to Twenty-Two Species of Extinct Humans
by G.J. Sawyer, Viktor Deak
Hardcover, 256 pages
Published June 28th 2007 by Yale University Press
Gen 5:9

Again with the inability to count.

You've got 23 species in your chart.

 

[Zaius137]

Top on my list…

Muntz engineering proves evolution biology.

“Muntzing is the practice and technique of reducing the components inside an electronic appliance to the minimum required for it to function. The term is named after the man who invented it, Earl "Madman" Muntz, a car and electronics salesman who was also a self-taught electrical engineer.”
http://en.wikipedia.org/wiki/Madman_Muntz

Evolution researchers by damaging DNA and RNA sequences and evaluating the fitness of the resulting organism are in essence “Muntzing”. Because a direct parallel can be drawn between the shortcomings of Muntzing and evolutionary research we can extrapolate an outcome to evolutionary thought. Mad man Muntz never clipped a component from a radio and came up with a TV. This same shortcoming is obvious in evolution research. Parallels are…

• Muntzing never adds new information
• Muntzing never originates a new device
• Muntzing never preserves none functional components

The compliments to evolution are…

• Evolution never adds new information
• Evolution never is the origin of life
• Evolution can not preserve temporal non-coding DNA

Muntzing and evolution are analogous…

 

[mpok1519]

who defined it as that?

is that a real scientific concept? One named by a zany fictional corvair salseman?

 

[Split Rock]

[*]Evolution never adds new information

Define "information" in this context. Give us a way of measuring "information" and an example of a situation where information increases.

[*]Evolution never is the origin of life

No one ever claimed it explained the origin of life.

[*]Evolution can not preserve temporal non-coding DNA

If DNA is non functional, evolution is not likely to preserve it, yes. Although it can be fixed by genetic drift. This explains, btw, why there is so much variation between species in non-coding reagions of DNA.

 

[Doveaman]

why even discuss science with people who don't understand it?

Tell them to go school, or read a book.

Is that how you study the universe? From a book?

Why waste your time with people who simply want to refuse to acknowledge the facts because they've been mislead with falsehoods their whole lives?

And you learned all this from a book?

Sounds like faith to me.

 

[Zaius137]

Split Rock….
“Define "information" in this context. Give us a way of measuring "information" and an example of a situation where information increases”.
The example of measuring information hangs in Information Theory (well established by the way). In terms of entropy you could say a reduction of entropy is an increase in information in a system. The alphabet is a reduction in entropy.

“No one ever claimed it explained the origin of life.”
That is wrong… Darwin himself did and it was picked up latter by others. When it was found that the science could not be established the New Evolution synthesis gave it up. The letter from Darwin:
C. Darwin The Life and Letters of Charles Darwin, ed. Francis Darwin (London: John Murray 1887, Vol. III), 18.


“If DNA is non functional, evolution is not likely to preserve it, yes. Although it can be fixed by genetic drift. This explains, btw, why there is so much variation between species in non-coding reagions of DNA.”

I think the evolutionist must answer that one. Because as a Creationist I believe the information originated by intelligence and the Bible strictly states “each after its own kind”.

 

[LittleLambofJesus]

Again with the inability to count.

You've got 23 species in your chart.

How could you tell?

 

[razeontherock]

“No one ever claimed it explained the origin of life.”
That is wrong… Darwin himself did and it was picked up latter by others. When it was found that the science could not be established the New Evolution synthesis gave it up. The letter from Darwin:
C. Darwin The Life and Letters of Charles Darwin, ed. Francis Darwin (London: John Murray 1887, Vol. III), 18.


“If DNA is non functional, evolution is not likely to preserve it, yes. Although it can be fixed by genetic drift. This explains, btw, why there is so much variation between species in non-coding reagions of DNA.”

I think the evolutionist must answer that one. Because as a Creationist I believe the information originated by intelligence and the Bible strictly states “each after its own kind”.

Yes, and this is also perfectly compatible with the modern concept of "common ancestry," in that our Creator and designer imbedded His own image and likeness into all of Creation, all as varying means of revealing Himself.

Even the heavens declare the Glory of G-d, and on the other end of the spectrum so do the tiniest particles.

 

[Zaius137]

Mpok1519
This is my hypothesis and is being peer reviewed by this forum.
Zaius137

 

[LittleLambofJesus]

Yes, and this is also perfectly compatible with the modern concept of "common ancestry," in that our Creator and designer imbedded His own image and likeness into all of Creation, all as varying means of revealing Himself.

Even the heavens declare the Glory of G-d, and on the other end of the spectrum so do the tiniest particles.

Can't argue wit dat

http://www.olivetree.com/cgi-bin/EnglishBible.htm

2 Peter 1:17 For He received from God the Father honor and glory when such a voice came to Him from the Excellent Glory: "This is My beloved Son, in whom I am well pleased."
[Deut 18/Matt 17:5/Acts 3:22/Revelation 2:18]

Revelation 7:12 saying, "Amen! the blessing and the glory and the wisdom and the thanksgiving and the honour and the power and the strength, [are] to our God--to the ages of the ages! Amen!"

 

[Split Rock]

Split Rock….
“Define "information" in this context. Give us a way of measuring "information" and an example of a situation where information increases”.
The example of measuring information hangs in Information Theory (well established by the way). In terms of entropy you could say a reduction of entropy is an increase in information in a system. The alphabet is a reduction in entropy.

How is "the alphabet" a reduction in entropy?
Let me give you two DNA sequences. Please tell us which carries more information:

AGAGTTAATTTTC
CATCTGGTGACCA

[“No one ever claimed it explained the origin of life.”
That is wrong… Darwin himself did and it was picked up latter by others. When it was found that the science could not be established the New Evolution synthesis gave it up. The letter from Darwin:
C. Darwin The Life and Letters of Charles Darwin, ed. Francis Darwin (London: John Murray 1887, Vol. III), 18.

This is incorrect. The theory of evolution explains the origin of species not the origin of life. Hense the name of Darwin's book. The new synthesis had to do with encorporating genetics into evolutionary theory. It had nothing to do with dropping anything to do with the origin of life. If you have a specific link or paragraph from a letter that says otherwise, please provide it. I'm not going to look up "The Life and Letters of Charles Darwin."

[“If DNA is non functional, evolution is not likely to preserve it, yes. Although it can be fixed by genetic drift. This explains, btw, why there is so much variation between species in non-coding reagions of DNA.”

I think the evolutionist must answer that one. Because as a Creationist I believe the information originated by intelligence and the Bible strictly states “each after its own kind”.

And no biologist would say diffferently. Our ancestors were eukaryotes, animals, vertebrates, tetrapods, mammals, primates, and apes... just like us. As I like to say, you cannot escape your heredity. However, this does not preclude descent with modification.

 

[LittleLambofJesus]

How is "the alphabet" a reduction in entropy?
Let me give you two DNA sequences. Please tell us which carries more information:

AGAGTTAATTTTC
CATCTGGTGACCA

This is incorrect. The theory of evolution explains the origin of species not the origin of life. Hense the name of Darwin's book. The new synthesis had to do with encorporating genetics into evolutionary theory. It had nothing to do with dropping anything to do with the origin of life. If you have a specific link or paragraph from a letter that says otherwise, please provide it. I'm not going to look up "The Life and Letters of Charles Darwin."

And no biologist would say diffferently. Our ancestors were eukaryotes, animals, vertebrates, tetrapods, mammals, primates, and apes... just like us. As I like to say, you cannot escape your heredity. However, this does not preclude descent with modification.

Good point

 

[cupid dave]

Yes, and this is also perfectly compatible with the modern concept of "common ancestry," in that our Creator and designer imbedded His own image and likeness into all of Creation, all as varying means of revealing Himself.

Even the heavens declare the Glory of G-d, and on the other end of the spectrum so do the tiniest particles.

Hmmm...

I know its difficult to accept new points of view, but consider that Christ said he, himself, was Truth.
He said he personified what is true.

That logically defines the father of Truth as the image in the mind of men that corresponds with Reality.

I am saying that logically, since he son is Truth, his Father is almighty Reality.

 

[cupid dave]

Posted by cupid dave
?

Old paradigms die hard.
The Fundamentalist christians on the one side, and the psuedo-science literati on the other, tend to hold on to what they repeat from the last generation in spite of the evidence I show you here.

Genesis cleasrly see these 22 links oin the ascent of modern man as species because Gen 5:2 says so:

Genesis 5:2Male and female created he THEM; and blessed THEM, and called THEIR name Adam, (a species or kind) in the day when THEY were created.

Phil and I classify ourselves as a full fleged fundies...don't you?

http://www.christianforums.com/t7350852-3/#post51039724
Fundies....What defines one?

Hmmm...
I am a Theistic Evolution Bible Believer:
http://kofh2u.tripod.com/i

 

[Doveaman]

Yes, and this is also perfectly compatible with the modern concept of "common ancestry," in that our Creator and designer imbedded His own image and likeness into all of Creation, all as varying means of revealing Himself.

Even the heavens declare the Glory of G-d, and on the other end of the spectrum so do the tiniest particles.

That's nice. I like that. Permit me to use it some time. Embedded God.

“For since the creation of the world God's invisible qualities — His eternal power and divine nature — have been clearly seen, being understood from what has been made, so that men are without excuse.”(Rom 1:20).

 

[Loudmouth]

The example of measuring information hangs in Information Theory (well established by the way). In terms of entropy you could say a reduction of entropy is an increase in information in a system. The alphabet is a reduction in entropy.

So here is a DNA sequence:

ATCATCTCACGGCGAAAGTCGGGGGGACAGCAGCCGCTGCAGACATTATA

What does this sequence look like when it A) gains information, and B) loses information.

That is wrong… Darwin himself did and it was picked up latter by others.

He clearly divided the two.

"There is grandeur in this view of life, with its several powers, having been originally breathed into a few forms or into one; and that, whilst this planet has gone cycling on according to the fixed law of gravity, from so simple a beginning endless forms most beautiful and most wonderful have been, and are being, evolved."--Origin of Species, Charles Darwin.

He actually stated that the first forms or form had life breathed into it, and from this simple beginning life evolved. This has been the position of the theory FROM THE VERY START.

I think the evolutionist must answer that one. Because as a Creationist I believe the information originated by intelligence and the Bible strictly states “each after its own kind”.

What evidence do you have to back this up?

 

[Loudmouth]

Hmmm...

I know its difficult to accept new points of view, but consider that Christ said he, himself, was Truth.
He said he personified what is true.

That logically defines the father of Truth as the image in the mind of men that corresponds with Reality.

I am saying that logically, since he son is Truth, his Father is almighty Reality.

Then I define myself as Truth. Anything I say from here out is the Truth.

Wow, this theology stuff is easy. All you need to do is write something down and it becomes true.

 

[razeontherock]

Then I define myself as Truth. Anything I say from here out is the Truth.

Wow, this theology stuff is easy. All you need to do is write something down and it becomes true.

No no, you have it all wrong. You have to say it. LOUD. With a LOUD MOUTH. Preferably a trumpet. Then it becomes true

 

[Huram Abi]

Posted by cupid dave


Hmmm...
I am a Theistic Evolution Bible Believer:
http://kofh2u.tripod.com/i

Well, considering that it is your work, that isn't surprising.