• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

Evolution/Creation on Trial

Status
Not open for further replies.

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
I did. I see that you choose to ignore scientists when they say things you don't want to hear. Hmm. Interesting.
Do you think Williams was in the habit of making assertions in his conclusions without evidence to support them?
 
Upvote 0

paulm50

Well-Known Member
Feb 5, 2014
1,253
110
✟2,061.00
Gender
Male
Faith
Humanist
Marital Status
Married
OK, so we hear a lot on this forum that masses of evidence overwhelmingly confirms evolution to the extent that for all intents and purposes it can be regarded as fact. In that case, can someone please present a non-scientist like myself with perhaps half a dozen pieces of evidence that if presented in a court of law, would be sufficient to convince a jury that evolution were true beyond all reasonable doubt. At least one of these should directly relate to the claim that one type of creature (e.g., a reptile) can turn into a bird, with some examples of actual creatures where this has happened or is happening.
The process took millions of years. A feather is a a bunch of hairs linked together and over time, the hairs on some dinosaurs linked together to form a few feathers. As these dinosaurs became able to survive better by climbing trees, jumping off logs and rocks. They passed their genes on. The feathers may have attracted better mates, like it happens today with birds. Dinosaurs to birds transitional fossils.

By multiplying it 100 there's little change, 1,000 times and a little change is seen, 1 million times and we arrive at birds. This could be backed up with illustrations of similar bones structures of dinosaurs and birds and the actual bones themselves.

Let’s flip the coin now. Can someone also present a similar amount of ideas presented by creation scientists that can be shown to be false, again using the above court room scenario.
There is no court room level evidence. Genesis is easily shot down on cross. The first Humans on Earth were hunter gatherers out of Africa.
Finally, could someone answer the question about how the first life could have got started all on its own without any divine intervention. In particular, where all the information came from to start life and build the first self-reproducing cell and how the problem of chirality could have been overcome in such a process.
The Earth's core is molten lava. On the bottom of the sea there are outlets spewing out volcanic lava and gases. There are living species that have been created by the volcanic action.
Since you would be presenting these ideas to non-scientists, could you for each piece of evidence you present, indicate what the specialism of any scientist working in that field would need to have.
What I presented is merely scratching the surface and being updated all the time.

I barely touched on the evidence against the Creationist theory. Because it has stopped at a dead end. Either a creator kept coming back tweaking the design of the 100s of millions of species, or evolution was doing it. The other gap is the age of the Earth and Man, some insist on. Bones from 6,000 and longer have survived better, are plentiful and some still contain DNA. 500,000 years ago. They're very rough, very few and no DNA. Millions of years ago, they've been turned into rock or fossil fuel. If the Earth was 7,000 years old. There would be no coal, oil or gas. If god put it where he did, Islam is his real religion. They had the most of the most essential product to keep us going.

Hominids are a family, from which Homo Sapiens emerged, late in the process. Hominids evolved from tree dwelling Apes, we have recently found an upright walking ape with feet able to grasps branches. It walked upright as normal, which apes don't do. This was in a forest environment, which has forced a change in thinking. Did it come down to the ground for better pickings of fruit, nuts and berries, but retained the ability to scuttle up a tree if in danger? We don't know. But it walked upright and climbed like an Ape. A missing link.
 
Upvote 0

Smidlee

Veteran
May 21, 2004
7,076
749
NC, USA
✟21,162.00
Gender
Male
Faith
Baptist
Marital Status
Married
What is the information in this DNA sequence?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC
If someone speak in a code , that is a language, that I don't understand then it will only sound like noise ... It may as well be "Junk sound". In order for someone to know the information in a code they have to know the language of that code. The genetic code is not in English so it's going to many years of hard work for man to crack the many codes in the DNA.
Spies tries to hide code while other spies tries to find the hidden code that the average person would see as junk or noise.

The simplest bacteria appear have been built by someone that is a million times smarter than man so it going to take a very long time for man to crack the genetic code.
 
Upvote 0

The Cadet

SO COOL
Apr 29, 2010
6,290
4,743
Munich
✟60,617.00
Gender
Male
Faith
Atheist
Marital Status
In Relationship
Politics
US-Democrat
That's like asking " Please point to the specific part of this text that is not explained by pixels on a monitor."

Oh, that's easy. There is no chemical mechanism that unpacks the pixels and forms protein sequences based on it. The image of the text only causes any process when filtered through the emergent mind of a being with the capability of understanding it.

If suddenly there were founnd change some parts of the human DNA that so happen killing a certain race of people would you assume it nothing but "chemical processes" involved?

These chemical processes can be phenomenally meaningful, medically speaking. They can lead to important treatments and therapies. They matter to us. But let's not confuse the philosophical aspect (as Once does) with the scientific aspect. At its core, DNA is nothing more than chemicals interacting with other chemicals. Throughout the entire process of the cell "reading" DNA to form proteins, at no point is any intelligent process necessary.

You tell us, your the one that claims to be the genetic expert - so what's it say Loud? Or in reality is it all just unknown meaningless arrangement of letters that you don't have a clue as to what it is saying?

Fun fact: to information theory, it doesn't matter. The string "Jesus is lord" has the same information content as "asdfjklöieosp".

^_^

However, please show me the difference in your point of view?

I have little interest in philosophical debates over what form consciousness takes. It's not a field I have explored in any significant depth and I don't find it particularly relevant to this topic. Suffice it to say that regardless of the source of an idea, the idea should be evaluated on its own merits*. It doesn't matter if I'm an emergent property of a complex neural network, a complex AI program, a soul inhabiting a body, or a bottle of Dr. Pepper fizzing atheistically. The concepts stand and fall regardless of whether their source is conscious. I don't know about you, but I at least am fairly decently convinced that I have at least the illusion of consciousness going, and I choose to believe that other humans are not philosophical zombies, so...

*Unless the source is Spirit Science. **** that guy. :D
 
Upvote 0

Smidlee

Veteran
May 21, 2004
7,076
749
NC, USA
✟21,162.00
Gender
Male
Faith
Baptist
Marital Status
Married
Here is why evolutionist are afraid of the results produce by ENCODE.
Here is a quote from Dan Graur:
"If the human genome is indeed devoid of junk DNA as implied by the ENCODE project, then a long,undirected evolutionary process cannot explain the human genome. If, on the other hand, organisms are designed, then all DNA, or as much as possible, is expected to exhibit function. If ENCODE is right, then Evolution is wrong."

The best evidence against evolution comes from evolutionist. :)
 
Upvote 0

Justatruthseeker

Newbie
Site Supporter
Jun 4, 2013
10,132
996
Tulsa, OK USA
✟200,004.00
Country
United States
Gender
Male
Faith
Non-Denom
Marital Status
Widowed
Politics
US-Others
The process took millions of years. A feather is a a bunch of hairs linked together and over time, the hairs on some dinosaurs linked together to form a few feathers. As these dinosaurs became able to survive better by climbing trees, jumping off logs and rocks. They passed their genes on. The feathers may have attracted better mates, like it happens today with birds. Dinosaurs to birds transitional fossils.

By multiplying it 100 there's little change, 1,000 times and a little change is seen, 1 million times and we arrive at birds. This could be backed up with illustrations of similar bones structures of dinosaurs and birds and the actual bones themselves.

There is no court room level evidence. Genesis is easily shot down on cross. The first Humans on Earth were hunter gatherers out of Africa.
The Earth's core is molten lava. On the bottom of the sea there are outlets spewing out volcanic lava and gases. There are living species that have been created by the volcanic action.
What I presented is merely scratching the surface and being updated all the time.

I barely touched on the evidence against the Creationist theory. Because it has stopped at a dead end. Either a creator kept coming back tweaking the design of the 100s of millions of species, or evolution was doing it. The other gap is the age of the Earth and Man, some insist on. Bones from 6,000 and longer have survived better, are plentiful and some still contain DNA. 500,000 years ago. They're very rough, very few and no DNA. Millions of years ago, they've been turned into rock or fossil fuel. If the Earth was 7,000 years old. There would be no coal, oil or gas. If god put it where he did, Islam is his real religion. They had the most of the most essential product to keep us going.

Hominids are a family, from which Homo Sapiens emerged, late in the process. Hominids evolved from tree dwelling Apes, we have recently found an upright walking ape with feet able to grasps branches. It walked upright as normal, which apes don't do. This was in a forest environment, which has forced a change in thinking. Did it come down to the ground for better pickings of fruit, nuts and berries, but retained the ability to scuttle up a tree if in danger? We don't know. But it walked upright and climbed like an Ape. A missing link.

But when are you first going to go back and correct all the mistakes in classification so we may discuss the evidence? When are they going to stop claiming everything is a new species - just so they can get their names in the books as the discoverer of a new species?

Just when are they going to remove half of those claimed transitional's from the human lineage so we can have a proper scientific discussion of what is left?

Just when are they going to stop falsely claiming that finches that have been interbreeding from the start underwent speciation in the first place and are separate species?

When, oh when, are they going to stop classifying these as separate species:
images

And start classifying them by direct empirical evidence as to what is observed?
small-dog-breeds-17.jpg


When are they going to stop calling so-called "ring species" different species when they have simply adapted to local conditions are are nothing but infraspecific taxa - subspecies of the same species?

"Presence of specific locally adapted traits may further subdivide species into "infraspecific taxa" such as subspecies (and in botany other taxa are used, such as varieties, subvarieties, and formae)."

As a matter of fact, when are they going to actually start using their own definitions? So when are they going to do this so I know when 90% of the false evidence relied upon has been removed?

When are they going to quit ignoring the source of that heat in the core and mantle?

https://en.wikipedia.org/wiki/Birkeland_current
https://en.wikipedia.org/wiki/Induction_heating
https://en.wikipedia.org/wiki/Telluric_current

And quit asking I have "faith" in a perpetual motion machine spinning against friction for 4+ billion years, hidden from sight at the core?

When are they going to quit ignoring those vast underground oceans that should be erupting into steam, if they are correct about the molten state of the core?

http://www.iflscience.com/environment/huge-underground-ocean-discovered-towards-earths-core

Or can we assume that crystalline structure is simply water impregnated rock?

http://www.nytimes.com/1995/04/04/s...h-may-be-a-gigantic-crystal-made-of-iron.html

Iron which we know when in a molten state does not form crystalline structures - the molecules not aligning.

When oh when are they going to stop ignoring the science in favor of that Fairie Dust?
 
Upvote 0

paulm50

Well-Known Member
Feb 5, 2014
1,253
110
✟2,061.00
Gender
Male
Faith
Humanist
Marital Status
Married
What on earth has domestication of animals got to do with proving that evolution is true? Please provide some real evidence, like one kind of creature turning into another. This is regularly shown as being a fact on the so-called evolutionary tree of life, but if you remove all the dotted lines, you are left with the creationists' "orchard of life" which they say, matches the real world we see around us.
The domestication of animals is an excellent example of how easy it is to change animals by steering the breeding process. This can be done very quickly in a matter of 100 years.

Now take the same process and multiply it by 10,000, = 1,000,000 years. Killing off all the offspring who don't fit your eventual goal. That's a small chunk f time. Dinosaurs roamed the planet for about 165 million years. 1,650,000 times that only covered the dinosaur species.
First Dinosaurs. Approximately 230 million years ago
First Dinosaurs with both feathers and scales Based on fossil finds so far, theropods and the dinosaurian ancestors of the birds split 220 million years ago, indicating that they shared a feathered ancestor. With this discovery, paleontologists are wondering whether all early dinosaurs had proto-feathers.

Do you see how we have to stop thinking inside our life box and start to multiply something as simple as a mongrel dog changing two breeds, by millions?

Creationist keep asking the "How can" question. The answer is very slowly over millions of years. Like the Africans who came out of Africa 100,000 years ago, turned white.
 
Upvote 0

paulm50

Well-Known Member
Feb 5, 2014
1,253
110
✟2,061.00
Gender
Male
Faith
Humanist
Marital Status
Married
Upvote 0

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
The process took millions of years. A feather is a a bunch of hairs linked together and over time, the hairs on some dinosaurs linked together to form a few feathers. As these dinosaurs became able to survive better by climbing trees, jumping off logs and rocks. They passed their genes on. The feathers may have attracted better mates, like it happens today with birds. Dinosaurs to birds transitional fossils.

By multiplying it 100 there's little change, 1,000 times and a little change is seen, 1 million times and we arrive at birds. This could be backed up with illustrations of similar bones structures of dinosaurs and birds and the actual bones themselves.

There is no court room level evidence. Genesis is easily shot down on cross. The first Humans on Earth were hunter gatherers out of Africa.
The Earth's core is molten lava. On the bottom of the sea there are outlets spewing out volcanic lava and gases. There are living species that have been created by the volcanic action.
What I presented is merely scratching the surface and being updated all the time.

I barely touched on the evidence against the Creationist theory. Because it has stopped at a dead end. Either a creator kept coming back tweaking the design of the 100s of millions of species, or evolution was doing it. The other gap is the age of the Earth and Man, some insist on. Bones from 6,000 and longer have survived better, are plentiful and some still contain DNA. 500,000 years ago. They're very rough, very few and no DNA. Millions of years ago, they've been turned into rock or fossil fuel. If the Earth was 7,000 years old. There would be no coal, oil or gas. If god put it where he did, Islam is his real religion. They had the most of the most essential product to keep us going.

Hominids are a family, from which Homo Sapiens emerged, late in the process. Hominids evolved from tree dwelling Apes, we have recently found an upright walking ape with feet able to grasps branches. It walked upright as normal, which apes don't do. This was in a forest environment, which has forced a change in thinking. Did it come down to the ground for better pickings of fruit, nuts and berries, but retained the ability to scuttle up a tree if in danger? We don't know. But it walked upright and climbed like an Ape. A missing link.
It is best to make sure you are speaking about YEC. Creationism is not only a YEC position.
 
Upvote 0

Justatruthseeker

Newbie
Site Supporter
Jun 4, 2013
10,132
996
Tulsa, OK USA
✟200,004.00
Country
United States
Gender
Male
Faith
Non-Denom
Marital Status
Widowed
Politics
US-Others
Fun fact: to information theory, it doesn't matter. The string "Jesus is lord" has the same information content as "asdfjklöieosp".

Let's test that theory with the evolutionists.

http://ghr.nlm.nih.gov/handbook/basics/dna
"The information in DNA is stored as a code made up of four chemical bases: adenine (A), guanine (G), cytosine (C), and thymine (T). Human DNA consists of about 3 billion bases, and more than 99 percent of those bases are the same in all people. The order, or sequence, of these bases determines the information available for building and maintaining an organism, similar to the way in which letters of the alphabet appear in a certain order to form words and sentences."

http://www.nature.com/scitable/topicpage/dna-is-a-structure-that-encodes-biological-6493050
"Encoded within this DNA are the directions for traits as diverse as the color of a person's eyes, the scent of a rose, and the way in which bacteria infect a lung cell."

http://www.nature.com/scitable/topicpage/the-information-in-dna-is-decoded-by-6524808

http://www.livescience.com/37247-dna.html

http://www.pnas.org/content/69/10/2904.short

http://www.sciencedirect.com/science/article/pii/009286749090088V

http://www.sciencemag.org/content/160/3834/1308.short

http://www.sciencemag.org/content/337/6102/1628.short

http://www.sciencedirect.com/science/article/pii/0092867483903021

No, I'd say you all seem to be at odds with your own evolutionary biologists.

https://en.wikiquote.org/wiki/DNA

  • Richard Dawkins, River Out of Eden: A Darwinian View of Life (1995), p. 133.
There is enough storage capacity in the DNA of a single lily seed or a single salamander sperm to store the Encyclopædia Britannica 60 times over. Some species of the unjustly called ‘primitive’ amoebas have as much information in their DNA as 1,000 Encyclopædia Britannicas.
It is so efficient that all the information . . . necessary to specify the design of all the species of organisms which have ever existed on the planet . . . could be held in a teaspoon and there would still be room left for all the information in every book ever written.
 
Last edited:
  • Like
Reactions: Smidlee
Upvote 0

justlookinla

Regular Member
Mar 31, 2014
11,767
199
✟43,175.00
Faith
Non-Denom
Marital Status
Married
Loudmouth's rock example is a perfect analogy - each of the trillions of atoms in a pebble is arranged in a specific, solid manner to form the end product, which is the rock.

Loudmouth's rock example is simply his usual attempt to change the focus from the topic of the forum....creation and evolution.

Why not stick with discussing design as related to the forum topics?
 
Upvote 0

Justatruthseeker

Newbie
Site Supporter
Jun 4, 2013
10,132
996
Tulsa, OK USA
✟200,004.00
Country
United States
Gender
Male
Faith
Non-Denom
Marital Status
Widowed
Politics
US-Others
Loudmouth's rock example is simply his usual attempt to change the focus from the topic of the forum....creation and evolution.

Why not stick with discussing design as related to the forum topics?

Because breed mating with breed producing new breeds (variation) according to the empirical evidence is not what they want to discuss. They don't want to discuss restructuring the fossil record to fit how we understand life propagates - by the recombination of genes producing new dominant and recessive traits.

They don't want to discuss Asian mating with African producing an Afro-Asian, with no transitory forms between. Or the Husky and Mastiff along with the Chinook. Nor it seems, do they want to discuss Finches, even if they are supposedly the prime example of speciation. But they just don't realize that dust is where we all say we came from. Some just futilely speculate that it was slime to man.
 
Upvote 0

pat34lee

Messianic
Sep 13, 2011
11,293
2,636
62
Florida, USA
✟89,330.00
Gender
Male
Faith
Messianic
Marital Status
Single
Just to name two prominent examples: Francis Collins and Ken Miller are both devout Christians and staunch advocates of evolution. As recently as 2005, more than half of biologists believed in god. There is no inherent divide between evolution and god, only between evolution and a literalist interpretation of the bible.

Many who call themselves Christians don't believe the bible. How they can claim to believe God and think he's a liar is beyond me.

And yet, you completely miss the point. Could your "common designer" create a creature with one eye? Or a mammal that isn't bilaterally symmetrical? Could your common designer create a creature whose DNA has a fifth and sixth nucleotide base?

Wouldn't that kind of defeat the purpose of common design? Everything was designed to fill a notch in a single ecosystem; earth.

...Dude, are you seriously citing the space jews guy as a source? I usually at least try to engage with a source, but my "gives a crap" jar for Spirit Science has been empty since I watched his History movie, took a drink every time he said something baseless and absurd, and ended up in the hospital in need of a new liver.

Ad hominem, poisoning the well. Deal with the facts, not the guy writing them. If you can't, concede the point.
 
Upvote 0
Status
Not open for further replies.