Evolution/Creation on Trial

[Smidlee]

I take it that you can't find information in DNA? You can't find design in a DNA sequence?

Just because you can't see the information on the DVD doesn't mean it's not there. That the same assumption made about Junk DNA.

Again, we have positive evidence for junk DNA. That positive evidence is the accumulation of mutations at a rate consistent with neutral drift. Please address this point. Please explain how every base in a DNA sequence can be changed without it losing function that is important to the organism.

They have positive evidence of hidden information in the Junk DNA found by a spy who knew crack hidden codes.

 

[Loudmouth]

I use this in reply:
Evolutionary biologists have failed to realize that they work with two more or less incommensurable domains: that of information and that of matter. These two domains will never be brought together in any kind of the sense usually implied by the term "reductionism.."

100% opinion. Doesn't define what the difference is, nor how to measure it.

The gene is a package of information, not an object... In biology, when you're talking about things like genes and genotypes and gene pools, you're talking about information, not physical objective reality... This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms. (George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995. p. 42-43)

All assertions with no science to back it up.

 

[Loudmouth]

Just because you can't see the information on the DVD doesn't mean it's not there. That the same assumption made about Junk DNA.

You claim there is information in DNA, so show it to us.

 

[Smidlee]

You claim there is information in DNA, so show it to us.

I already shown this form a evolutionist who crack a a hidden code.

 

[Loudmouth]

I already shown this form a evolutionist who crack a a hidden code.

Does this DNA sequence have a secret code?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC

Who wrote the code? Who is it written to? What does it mean?

 

[Smidlee]

Does this DNA sequence have a secret code?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC

Who wrote the code? Who is it written to? What does it mean?

Here is strong evidence there is hidden information in the so called Junk DNA.

 

[Justatruthseeker]

Where is your evidence that God did anything?

All around you, you just pretend that math that utterly fails at that beginning doesn't tell you the miracle better than I could. Where is yours that He didn't. See how easy those strawman arguments are?

Where is an intelligent designer involved in causing particles to interact?

Where is your random chance in particles that interact in precise mathematical ways? Ways that only an intelligent entity themselves can conceive of.

How is it non-physical?

Are you suggesting we abandoned aether theories for no good reason?

I am still not seeing evidence for an intelligent designer. Will that be coming any time soon?

Because we already know you ignore everything around you. Ignore that life propagates by breed mating with breed producing new breeds - and instead pretend they mutate into different species. You ignore all those interbreeding finches and call them separate species too. It's no wonder you can't see any evidence - you have blinded yourself to the world around you.

 

[Justatruthseeker]

Does this DNA sequence have a secret code?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC

Who wrote the code? Who is it written to? What does it mean?

You tell us, your the one that claims to be the genetic expert - so what's it say Loud? Or in reality is it all just unknown meaningless arrangement of letters that you don't have a clue as to what it is saying?

 

[Oncedeceived]

100% opinion. Doesn't define what the difference is, nor how to measure it.

All assertions with no science to back it up.

What I am finding with you is that you will accept ideas that you agree with whether or not they are in evidence or not but if you disagree these scientists are just making assertions. Hmmm. Interesting.

 

[Loudmouth]

Here is strong evidence there is hidden information in the so called Junk DNA.

I am not going to watch a 1 hour video. Present the evidence in your own words.

 

[Loudmouth]

What I am finding with you is that you will accept ideas that you agree with whether or not they are in evidence or not but if you disagree these scientists are just making assertions. Hmmm. Interesting.

Notice that you STILL can't present scientific evidence. Hmmm. Interesting.

 

[Smidlee]

I am not going to watch a 1 hour video. Present the evidence in your own words.

DNA is loaded with information and some of it is still hidden waiting to be uncovered.

 

[Loudmouth]

You tell us, your the one that claims to be the genetic expert - so what's it say Loud? Or in reality is it all just unknown meaningless arrangement of letters that you don't have a clue as to what it is saying?

I am not the one claiming that there is information in DNA sequences.

 

[Loudmouth]

DNA is loaded with information and some of it is still hidden waiting to be uncovered.

What is the information in this DNA sequence?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC

 

[Oncedeceived]

You just went full Sye Ten. Never go full Sye Ten.

However, please show me the difference in your point of view?

 

[Oncedeceived]

Notice that you STILL can't present scientific evidence. Hmmm. Interesting.

What? The quote I gave was not made by me, you know that right?

 

[Loudmouth]

What? The quote I gave was not made by me, you know that right?

The quote that you gave me does not contain any scientific evidence. Notice that you still haven't presented any scientific evidence for design. Hmmmm. Interesting.

 

[Justatruthseeker]

I am not the one claiming that there is information in DNA sequences.

That simple snippet of code tells billions of things how to interact and build up DNA, RNA and proteins one molecule at a time. Tells conglomerates of these molecules how to interact and make further parts of you one molecule at a time, until the cell is built. Each part receiving a different transmission of information to complete just it's job. None of it random, all in precise orderly fashion.

So how did you get here Loud, if that DNA does not contain the information to build you? Are you now claiming information is not passed generation to generation? That mutations contain no information to create new patterns? Why is that Junk DNA Junk if it's no different than the rest, since apparently it too carries no information?

 

[Loudmouth]

That simple snippet of code tells billions of things how to interact and build up DNA, RNA and proteins one molecule at a time.

How so? Does DNA have a low voice, or a high voice? What kind of accent does DNA have?

So how did you get here Loud, if that DNA does not contain the information to build you?

DNA alone won't do it.

 

[Oncedeceived]

The quote that you gave me does not contain any scientific evidence. Notice that you still haven't presented any scientific evidence for design. Hmmmm. Interesting.

Do you think as a scientist, William used assertions in his conclusions without evidence?