• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

Evolution/Creation on Trial

Status
Not open for further replies.

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Well then lets be more specific about the information. DNA contains meaningful, purposeful, specific information that is like a code with instructions that has the ability to not only store information, but command other cells, and replicate itself.

DNA does not command anything, and all of the other attributes are found in all other matter. DNA is as much a code as:

2H2 + O2 ----> 2H2O

Hydrogen and oxygen carry the information for water in the same way that DNA carries the information for the chemical reactions it is a part of.

It also has the ability to build more components of cells and of course has parts that carry this genetic information too.

Not by itself, it doesn't. It is a chemical, just like all other molecules.

So you would say that a rock the size of the human brain would contain the same amount of information that the human brain does?

Yes, it would. In fact, the rock would contain more information since rocks tend to be denser than craniums. What you seem to be hung up on is that you think information you care about is somehow different from information you don't care about. All you have is a bias towards information found in DNA and brains compared to other physical objects.

So you don't know if the first DNA arose from necessity? Or for a purpose? Or to perform specific actions? However, it is necessary, has a purpose and does perform specific actions in which evolution is dependent upon.

Why don't you tell us where it came from with evidence for all of the steps.
 
Upvote 0

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
Do you know anything about information theory? That is, the branch of computer science that deals with the matter of information? If you impose a code onto anything, you can produce information from it. Loudmouth's rock example is a perfect analogy - each of the trillions of atoms in a pebble is arranged in a specific, solid manner to form the end product, which is the rock. And to information theory, it does not matter if that pebble is the hope diamond or a lump of coal; so long as the same number of atoms with the same entropy are present, the information content is the same. Similarly, if we impose the code of CAGT onto DNA nucleotides, it doesn't matter whether a string with a known length forms a human or an amoeba or a malformed mess of non-functional proteins; it contains the same information.
This is more in line with pattern. There are patterns in all matter. Snowflakes and tornadoes have pattern and contain information but they do not have intent, they do not require a communicator or a receiver of the information.
Look, I'm sorry, but you keep invoking information and I keep getting more and more of an impression that you have no idea what it is. Please define the term "information" as you are using it, and then stick to that definition.

Information: “the communication or reception of knowledge or intelligence.”

Just like any pseudorandom stochaistic process can give us information.
Does any pseudorandom stochaistic process communicate the information and receive the information?
A physical system, or a mathematical model of a system which produces such a sequence of symbols governed by a set of probabilities, is known as a stochastic process. We may consider a discrete source, therefore, to be represented by a stochastic process. Conversely, any stochastic process which produces a discrete sequence of symbols chosen from a finite set may be considered a discrete source.​
Pattern or order?

That's from Shannon's 1948 paper - the paper which, in essence, created the field of information theory. DNA contains information in the exact same was as any pseudorandom process. You could derive information from atomic decay. You could derive it from the order of atoms in a rock. You could derive it from the number of fish swimming down a particular river. It doesn't matter. You cannot simply single out DNA like this; it is not some special case.
But I can. I can single it out because it is not just a pattern or order that information can be derived from, but a it is also a language in that it contains and transmits information. It holds intent in that it instructs and sends those instructions on. It contains letters-Codons, it contains words-Genes, it contains sentence-Operon and paragraph-Regulon, it has error correction and it has redundancy which like conversation if you miss every other word you can still follow along. The DNA molecule itself is an encoding-decoding system that transmits reproducible information. We have no examples of a code or language coming from anything but a mind…there are no known exceptions.

Just like if you look at the order of atoms in a rock, you can determine what kind of rock it is. This is not impressive in any meaningful way. It all boils down to chemistry.
Exactly, YOU can determine what kind of rock it is, the rock doesn't have a language, it doesn't encode or decode nor does it have intent or instruction.

No, it illustrates that we currently have no viable model for how DNA arose, and that we have no good reasons to exclude naturalistic, random processes.
Except that we know that in all cases, natural processes do not have intent or purpose, goals or mind. Language, codes and purpose and instruction all are properties of mind. Information is that which is “the communication or reception of knowledge or intelligence” properties of the mind.

I don't know. I say that with honesty, integrity, and pride. I have no idea why the laws of physics are the way they are. I don't know if they could be different or if them being different has any meaning. I don't know why certain things in the universe appear to be constant. Do you have a falsifiable hypothesis which you can corroborate with evidence?
Honesty, a good attribute, integrity another great attribute but pride? Why pride?
 
Upvote 0

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
Care to define "information"? And, for that matter, "meaningful", "purposeful", "specific", or any of the rest of these vague terms you're throwing around as though their definitions weren't important to your argument?
A dictionary is only a google away.

I'll do the work for you:

Meaningful:
1
a : having a meaning or purpose

b : full of meaning : significant <a meaningful life>
2
: having an assigned function in a language system <meaningful propositions>

Purposeful:
1
: having a purpose: as
a : meaningful <purposeful activities>
b : intentional <purposeful ambiguity>
2: full of determination <was soft-spoken but purposeful>
 
Last edited:
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
This is more in line with pattern. There are patterns in all matter. Snowflakes and tornadoes have pattern and contain information but they do not have intent, they do not require a communicator or a receiver of the information.

You have never shown that DNA has intent. Also, . . .

2H2 + O2 ----> 2H2O

Hydrogen and oxygen have the same information with hydrogen communicating an electron and oxygen receiving it.

Information: “the communication or reception of knowledge or intelligence.”

Then DNA does not have information since it does none of those things.

But I can. I can single it out because it is not just a pattern or order that information can be derived from, but a it is also a language in that it contains and transmits information.

I can produce language analogies for regular chemical reactions as well.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
A dictionary is only a google away.

If you won't pick a definition, then we will pick one for you. This is the definition you will use.

"In physics, physical information refers generally to the information that is contained in a physical system. Its usage in quantum mechanics (i.e. quantum information) is important, for example in the concept of quantum entanglement to describe effectively direct or causal relationships between apparently distinct or spatially separated particles."

Therefore, all matter carries information in the same way as DNA, according to your definition.
 
Upvote 0

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
If you won't pick a definition, then we will pick one for you. This is the definition you will use.

"In physics, physical information refers generally to the information that is contained in a physical system. Its usage in quantum mechanics (i.e. quantum information) is important, for example in the concept of quantum entanglement to describe effectively direct or causal relationships between apparently distinct or spatially separated particles."

Therefore, all matter carries information in the same way as DNA, according to your definition.
I gave it and you commented on it.
 
Upvote 0

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
You have never shown that DNA has intent. Also, . . .

2H2 + O2 ----> 2H2O

Hydrogen and oxygen have the same information with hydrogen communicating an electron and oxygen receiving it.



Then DNA does not have information since it does none of those things.



I can produce language analogies for regular chemical reactions as well.

I use this in reply:
Evolutionary biologists have failed to realize that they work with two more or less incommensurable domains: that of information and that of matter. These two domains will never be brought together in any kind of the sense usually implied by the term "reductionism.." The gene is a package of information, not an object... In biology, when you're talking about things like genes and genotypes and gene pools, you're talking about information, not physical objective reality... This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms. (George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995. p. 42-43)
 
Upvote 0

The Cadet

SO COOL
Apr 29, 2010
6,290
4,743
Munich
✟60,617.00
Gender
Male
Faith
Atheist
Marital Status
In Relationship
Politics
US-Democrat
This is more in line with pattern. There are patterns in all matter. Snowflakes and tornadoes have pattern and contain information but they do not have intent, they do not require a communicator or a receiver of the information.

Wat.

Information: “the communication or reception of knowledge or intelligence.”

This definition does not belong in the same zip code as a discussion about DNA. By this definition, DNA does not contain information. In fact, no natural process not brought into being by intelligent creatures does. You're begging the question here - you're making an argument that attempts to prove that DNA must be intelligently designed because it contains information, and then you're smuggling that intelligence into the premise of what you mean by "information"!

If this is your definition of information, it is up to you to demonstrate that DNA contains information, by demonstrating that it communicates or receives knowledge or intelligence (as opposed to it being a pattern we read into the chemical interactions). Given that DNA existed for hundreds of millions of years before the first creature you could remotely call "intelligent" came along, I think that's a bit of a tough sell. You'd need to somehow prove...

...Oh. Well, we're back to square one then. Demonstrate that there is an intelligent designer. :)

Does any pseudorandom stochaistic process communicate the information and receive the information?

Given the way you're applying your definition to DNA, yeah. All of them. Your definition is flawed and you are begging the question. You're confusing chemical processes with intelligent reception of information.

But I can. I can single it out because it is not just a pattern or order that information can be derived from, but a it is also a language in that it contains and transmits information.

Given your definition of information, no, it does not contain or transmit information in any meaningful sense. I understand you're appealing to mechanisms like transcription and copying, but these are not intelligent functions. These are nothing more than a far more complex version of a natrium hydroxide/hydrochloric acid reaction.

It holds intent in that it instructs and sends those instructions on. It contains letters-Codons, it contains words-Genes, it contains sentence-Operon and paragraph-Regulon, it has error correction and it has redundancy which like conversation if you miss every other word you can still follow along. The DNA molecule itself is an encoding-decoding system that transmits reproducible information. We have no examples of a code or language coming from anything but a mind…there are no known exceptions.

This is a lousy argument from analogy. I'm sorry, but none of the elements of DNA require any sort of mind. They require chemistry. As a result, you can either get to "all codes and languages come from a mind" or "DNA is a code". But you can't get both.

Exactly, YOU can determine what kind of rock it is, the rock doesn't have a language, it doesn't encode or decode nor does it have intent or instruction.

Please point to the specific part of DNA that is not explained by chemical processes.

Except that we know that in all cases, natural processes do not have intent or purpose, goals or mind.

Please demonstrate that DNA has a purpose or goal. In whose mind does it have this purpose or goal? Stop begging the question.

A dictionary is only a google away.

...I'll get back to this. Right now I'm at a bit of an impasse with the one definition you did give me.
 
Upvote 0

The Cadet

SO COOL
Apr 29, 2010
6,290
4,743
Munich
✟60,617.00
Gender
Male
Faith
Atheist
Marital Status
In Relationship
Politics
US-Democrat
I use this in reply:
Evolutionary biologists have failed to realize that they work with two more or less incommensurable domains: that of information and that of matter. These two domains will never be brought together in any kind of the sense usually implied by the term "reductionism.." The gene is a package of information, not an object... In biology, when you're talking about things like genes and genotypes and gene pools, you're talking about information, not physical objective reality... This dearth of shared descriptors makes matter and information two separate domains of existence, which have to be discussed separately, in their own terms. (George C. Williams. The Third Culture: Beyond the Scientific Revolution. (ed. John Brockman). New York, Simon & Schuster, 1995. p. 42-43)
I sincerely doubt that this means what you think it means, because if it does, Williams has devolved into new-age nonsense.
 
Upvote 0

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
Wat.

This definition does not belong in the same zip code as a discussion about DNA. By this definition, DNA does not contain information. In fact, no natural process not brought into being by intelligent creatures does. You're begging the question here - you're making an argument that attempts to prove that DNA must be intelligently designed because it contains information, and then you're smuggling that intelligence into the premise of what you mean by "information"!

If this is your definition of information, it is up to you to demonstrate that DNA contains information, by demonstrating that it communicates or receives knowledge or intelligence (as opposed to it being a pattern we read into the chemical interactions). Given that DNA existed for hundreds of millions of years before the first creature you could remotely call "intelligent" came along, I think that's a bit of a tough sell. You'd need to somehow prove...

...Oh. Well, we're back to square one then. Demonstrate that there is an intelligent designer. :)

Given the way you're applying your definition to DNA, yeah. All of them. Your definition is flawed and you are begging the question. You're confusing chemical processes with intelligent reception of information.

Given your definition of information, no, it does not contain or transmit information in any meaningful sense. I understand you're appealing to mechanisms like transcription and copying, but these are not intelligent functions. These are nothing more than a far more complex version of a natrium hydroxide/hydrochloric acid reaction.

This is a lousy argument from analogy. I'm sorry, but none of the elements of DNA require any sort of mind. They require chemistry. As a result, you can either get to "all codes and languages come from a mind" or "DNA is a code". But you can't get both.

Please point to the specific part of DNA that is not explained by chemical processes.

Please demonstrate that DNA has a purpose or goal. In whose mind does it have this purpose or goal? Stop begging the question.

...I'll get back to this. Right now I'm at a bit of an impasse with the one definition you did give me.
IF I accept what you are saying here, I have to conclude that you have no intelligence because your brain is only matter and only chemical reactions determine your actions.

Your argument is a moot point and you have no reason for your position. You are only acting upon your chemical interactions.
 
Upvote 0

Smidlee

Veteran
May 21, 2004
7,076
749
NC, USA
✟21,162.00
Gender
Male
Faith
Baptist
Marital Status
Married
The didn't jump on the ENCODE bandwagon because the evidence demonstrates that it is junk.

"Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selection, which implies that at least 80 - 10 = 70% of the genome is perfectly invulnerable to deleterious mutations, either because no mutation can ever occur in these "functional" regions or because no mutation in these regions can ever be deleterious. This absurd conclusion was reached through various means . . ."
http://www.ncbi.nlm.nih.gov/pubmed/23431001
I had no doubt you get evolution believers goes against any science that doesn't support their world view. I knew Encode results would cause Junk DNA believers to go on the offense.
If it's junk then remove 90% of the DNA and see what happens. Junk DNA is just an argument of ignorance. Remember Encode was done by a large group of evolutionist.
The stronger the evidence that goes against evolution the stronger evolutionist tries to defend it.
 
Last edited:
Upvote 0

The Cadet

SO COOL
Apr 29, 2010
6,290
4,743
Munich
✟60,617.00
Gender
Male
Faith
Atheist
Marital Status
In Relationship
Politics
US-Democrat
IF I accept what you are saying here, I have to conclude that you have no intelligence because your brain is only matter and only chemical reactions determine your actions.

Your argument is a moot point and you have no reason for your position. You are only acting upon your chemical interactions.
You just went full Sye Ten. Never go full Sye Ten.
 
  • Like
Reactions: Paulos23
Upvote 0

Smidlee

Veteran
May 21, 2004
7,076
749
NC, USA
✟21,162.00
Gender
Male
Faith
Baptist
Marital Status
Married
Please point to the specific part of DNA that is not explained by chemical processes.
That's like asking " Please point to the specific part of this text that is not explained by pixels on a monitor."
If suddenly there were founnd change some parts of the human DNA that so happen killing a certain race of people would you assume it nothing but "chemical processes" involved?
 
Upvote 0

Justatruthseeker

Newbie
Site Supporter
Jun 4, 2013
10,132
996
Tulsa, OK USA
✟200,004.00
Country
United States
Gender
Male
Faith
Non-Denom
Marital Status
Widowed
Politics
US-Others
Information, all matter has it.

"In physics, physical information refers generally to the information that is contained in a physical system. Its usage in quantum mechanics (i.e. quantum information) is important, for example in the concept of quantum entanglement to describe effectively direct or causal relationships between apparently distinct or spatially separated particles."
https://en.wikipedia.org/wiki/Physical_information

And who's fault is it that they then believe this (energy - that carries information), came from nothing? Or did that energy just always exist as we believe in science which confirms the Biblical account of God?

And what is it that is causing this casual relationship between spatially separated particles? Are we still discussing fields on the quantum level, or do you hold to an aether type sea of quantum particles? Or are these quantum particles surrounded by the vacuum energy?

I know we are not discussing gravity here - since there is no quantum theory of gravity that conforms to observations. Basically we are discussing charged particles within the voltage field that fills all of space. If you like you can call it vacuum energy, or whatever floats your boat terminology wise.

It's not the information of the physical system you should really worry too much about - but that information that is transmitted from one physical system to another, through non-physical means, unless again we are back to considering aether theories? But then we already understand that physical systems are merely transformed energy. Agreed?

All the information you receive from these physical things - are also based upon energy - the entire electromagnetic spectrum, in which we measure these systems and deduce the information contained within. Contained within because each particle of matter that is transformed from energy - also contains this energy.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
That's like asking " Please point to the specific part of this text that is not explained by pixels on a monitor."

Tell me how you determine if DNA has information. Does this DNA sequence have information?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
And who's fault is it that they then believe this (energy - that carries information), came from nothing? Or did that energy just always exist as we believe in science which confirms the Biblical account of God?

Where is your evidence that God did anything?

And what is it that is causing this casual relationship between spatially separated particles? Are we still discussing fields on the quantum level, or do you hold to an aether type sea of quantum particles? Or are these quantum particles surrounded by the vacuum energy?

Where is an intelligent designer involved in causing particles to interact?

It's not the information of the physical system you should really worry too much about - but that information that is transmitted from one physical system to another, through non-physical means,

How is it non-physical?

All the information you receive from these physical things - are also based upon energy - the entire electromagnetic spectrum, in which we measure these systems and deduce the information contained within. Contained within because each particle of matter that is transformed from energy - also contains this energy.

I am still not seeing evidence for an intelligent designer. Will that be coming any time soon?
 
Upvote 0

Smidlee

Veteran
May 21, 2004
7,076
749
NC, USA
✟21,162.00
Gender
Male
Faith
Baptist
Marital Status
Married
Tell me how you determine if DNA has information. Does this DNA sequence have information?

GTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCC
This is like trying to determine how long a movie was just by examine the bumps on the back of the DVD. Did you know a spy can hide "information" in static? Do you understand that you need a DVD player to "read" the information off the DVD?
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
I had no doubt you get evolution believers goes against any science that doesn't support their world view. I knew Encode results would cause Junk DNA believers to go on the offense.

Notice that you didn't address anything I said. We have very good reasons for having problems with the definition of "functional" that ENCODE used. Simply doing something is not functional. They never determined if any of those functions actually had an impact on human fitness. If a stretch of DNA produced an RNA molecule on a very rare occasion, they counted that as fuctional without even determing if that RNA molecule did anything.

If it's junk then remove 90% of the DNA and see what happens. Junk DNA is just an argument of ignorance. Remember Encode was done by a large group of evolutionist.
The stronger the evidence that goes against evolution the stronger evolutionist tries to defend it.

Again, we have positive evidence for junk DNA. That positive evidence is the accumulation of mutations at a rate consistent with neutral drift. Please address this point. Please explain how every base in a DNA sequence can be changed without it losing function that is important to the organism.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
This is like trying to determine how long a movie was just by examine the bumps on the back of the DVD. Did you know a spy can hide "information" in static? Do you understand that you need a DVD player to "read" the information off the DVD?

I take it that you can't find information in DNA? You can't find design in a DNA sequence?
 
Upvote 0
Status
Not open for further replies.