Coccyx - tale of a creationist disinformation post

[USincognito]

At least he is not evolutionist. He is also well educated, having earned a PhD in Molecular and Cell Biology from University of California at Berkeley, where he also worked as a postdoctoral research biologist. But I understand he is also a wanted man:

That so melodramatic. But then again so isn't reason Wells pursued his doctorate.
The Words of the Wells Family

Father's words, my studies, and my prayers convinced me that I should devote my life to destroying Darwinism, just as many of my fellow Unificationists had already devoted their lives to destroying Marxism. When Father chose me (along with about a dozen other seminary graduates) to enter a Ph.D. program in 1978, I welcomed the opportunity to prepare myself for battle.​

I think his books are quite good; and the Icons of Evolutionism most certainly needed a good house-cleaning.

The whole Icons shtick is betraying a lack of depth of knowledge.

Have you read this review of his book titled, "The Myth of Junk DNA"?

Why would we read a book that has a falsehood right in the title? As an actual working geneticist pointed out earlier in the thread.

That's incorrect. Junk DNA means DNA that has no effect on the organism health or reproductive success; more precisely, DNA for which the specific sequence doesn't matter. Current estimates are that between 89% and 92% of the human genome consists of junk DNA; the former estimate comes from the ENCODE project and the latter is a more recent estimate. No one has ever published any evidence that most of the genome is anything but junk DNA -- certainly not the ENCODE project.

​

 

[USincognito]

What was that link again?

I have a feeling I'm going to need to post this quite frequently.
Common misconceptions about science I: “Scientific proof”

What do you think about this statement?

I think you did a Google search for "evolution" and "geology" and that was the best you could come up with. Note how he never said there was such a thing as "evolutionary geology". Just that geology was informed by evolution because of fossils and certain sedimentary rocks being comprised of certain plankton.

I'll bite. How do evolutionary geologists explain the extensive lamination of megasequence layering? How do evolutionary geologists explain paleocurrents? How do evolutionary geologists explain how coal seams like these formed?

I don't know because as I keep telling you "evolutionary geologists" don't exist. If you want to know how geologists explain those things, we can discuss them.​

How do evolutionary geologists explain polystrate fossils in coal seams?

They wouldn't because neither "evolutionary geologists" nor polystrate fossils exist.

No we don't. That is a myth perpetuated by the uninformed.

BRT =/= all Creationists or even most Creationists.

You did well until the last clause. There is no evidence for uniformitarianism. Zero.

And here you dishonestly ignore what I wrote as well as tell a falsehood. There is plenty of evidence of uniformitarianism, but not strict uniformatarianism. As I noted, we know the processes that occur today occurred the same in the past, but they included catastrophies like volcanic traps, ice ages, floods and impact events.

 

[USincognito]

Perhaps the embryologists at the Discovery Institute have been unable to find any correlation between the embryos typically depicted in the charts.

Or the more likely reason is there are no embryologists at Discovery Institute.

It is no doubt an example of simple variations within a species. Has it ever been touted as proof of evolution?

Common misconceptions about science I: “Scientific proof”

They are, however, evidence for evolution.

Has it ever been touted as proof of evolution?

Common misconceptions about science I: “Scientific proof”

Is is, however, evidence for evolution.

There is no evidence it is a transitional anything.

Hand waving, no matter how calm or furious, does not make the evidence from transitional fossils go away.
(A few) transitional fossils

 

[Jimmy D]

"There you have it. As you can see, these drawings are pervasive, continuing to misinform students as they’ve done for going on a century and a half.
"And you might see a trend publication dates of the offending textbooks. There are still some very recent textbooks (i.e., 2005 or younger) that use Haeckel’s drawings, but most of the textbooks in our list predate the year 2000. Why is that? It’s because 2000 was the year that Jonathan Wells published his book Icons of Evolution which raised the public’s consciousness about inaccuracies in biology textbooks, especially the prevalence of Haeckel’s faked embryo drawings. While some textbooks continue to promote the inaccurate “icons,” Wells’s book has had a positive impact, reducing the number of textbooks that use the fraudulent drawings."

Did you miss my post...

I spent over an hour trying to find evidence that Haeckel's drawings are being used in those particular books with little luck.

I was only able to find the embryo pictures in Sylvia Mader's book and they don't use Haeckael's drawings. His grid pattern / layout is used but the modern drawings are anatomically correct.

And it's not as if they are promoting Haeckel's recapitulation theory is it?

I was under the impression Haeckel was criticized for exaggerating certain anatomical features to emphasize his ideas? What's the problem with similar - but anatomically correct - drawings being used to demonstrate the developmental similarities between various species?

If your article was misleading in this instance I'm dubious about it's other claims.

Edit: I don't know what's going on with that image, it's showing up in the edit.

 

[USincognito]

Found this early yesterday. Please actually watch it before making a comment on it.

 

[Brightmoon]

This is one of Hutton’s unconformities. See if it matches the nonsense you tell yourself about it. This unconformity is obviously hard rock layers that were laid horizontally, then pushed vertically, then eroded down flat, then overlaid by other horizontal rock layers. Both layers are sedimentary.

 

[jamesbond007]

Amazingly, the ToE is NOT ABOUT the ORIGIN OF LIFE.

Life is about the origin of life.

 

[Brightmoon]

Life is about the origin of life.

. So what is this little aphorism supposed to mean?

 

[jamesbond007]

. So what is this little aphorism supposed to mean?

It means to apply your theories to life and see whether it works or not in reality.

 

[sfs]

If you have specific disagreements with Tomkins and Jeanson, let us hear them.

Sure. From the paper you cited: "BLASTN algorithm parameters for the main study were as follows: -word_size 11, -evalue 10, -max_target_seqs 1, -dust no, -soft_masking false, -ungapped." This is the set of parameters Tomkins used when comparing segments of chimp DNA with human DNA, using the standard program BLAST. His choice to add the "ungapped" parameter immediately tells anyone who understands sequence alignment that he's not trying to get a fair estimate of the sequence identity. When comparing sequences (whether between species or within a species), there are often small gaps in the comparison -- small insertions or deletions in one of the two lineages. The normal practice, and the default behavior of BLAST, is to penalize gaps but allow for them. With the ungapped parameter, however, gaps aren't allowed and the program can only match sequence on one side or the other of the gap. This is clearly not the way to measure sequence identity. For example, consider comparing these two sequences:

ACGGTCCATTGCAATCCGTA
ACGGTCCAT-GCAATCCGTA

The two sequences are 95% identical, and that's what BLAST will tell you -- unless you specify "ungapped", in which case it will tell you they're 50% identical.

This isn't a small effect, either. There are 5 million of these gaps when comparing the human and chimpanzee genomes, or one every 600 base-pairs. Tomkins is aligning the genomes in 300 bp chunks, so there should be on average ~1 gap in every other comparison, which translates into tossing out 12.5% of the genuine identity between the sequences.

It gets worse, though. Later, Tomkins writes, "In addition, the script used for making new fasta files also removed all ‘N’s from the chimp sequence that would have produced false alignments to the large spans of ‘N’s in the human assembly." (Note: 'N' in the sequence signifies missing data.) This makes no sense. Part of BLAST output is an estimate of how likely a particular match is to be found by chance in the entire genome; spurious matches because of lots of Ns are screened out by setting a threshold on this number. Instead, Tomkins appears to be deleting the Ns, actually introducing new gaps into the sequence.

This isn't a serious attempt at comparing human and chimpanzee DNA. It's a masquerade that looks like science but isn't.

 

[Abraxos]

. So what is this little aphorism supposed to mean?

It basically means the theory of evolution is baseless without a good theory on abiogenesis which it doesn't have.

I was under the impression Haeckel was criticized for exaggerating certain anatomical features to emphasize his ideas? What's the problem with similar - but anatomically correct - drawings being used to demonstrate the developmental similarities between various species?

The problem is that Haeckel didn't just "exaggerate" certain anatomical features, he outright changed them completely. What Haeckel did was take a human embryo and copied it, pretending that the salamander and the pig and all the others looked the same at the same stage of development. In fact they are all demonstrably different. Ridiculously so.

What pictures you looking at that give you the impression they were just "exaggerations?"

Today, this false premise of similarities between all animals at the embryonic stage of development is still being taught using selective animal embryos.

 

[sfs]

It basically means the theory of evolution is baseless without a good theory on abiogenesis which it doesn't have.

That's not what he said it meant. But if it had been what he meant, he would have been wrong.

 

[Jimmy D]

he problem is that Haeckel didn't just "exaggerate" certain anatomical features, he outright changed them completely. What Haeckel did was take a human embryo and copied it, pretending that the salamander and the pig and all the others looked the same at the same stage of development. In fact they are all demonstrably different. Ridiculously so.

What pictures you looking at that give you the impression they were just "exaggerations?"

I'm looking at the pictures we were discussing, that were used in modern textbooks. Of course the different species are demonstrably different, no one's claiming otherwise.... they also show similarities, which Haeckel grossly exaggerated in an attempt to demonstrate his ideas.

I'll be honest though chief, I couldn't care less if Haeckel lied, exaggerated or molested a turtle. Embryology has moved on since 1847, we know he was wrong, now where's that picture...

 

[Bible Research Tools]

Mmm hmm.

Some folks might fall for misusing words and phrases like that, but the science advocates here actually know what we're talking about. Evolution is science. Period.

Is evolution falsifiable without a time machine?

Heh. There are literally (and I mean literally) millions of potential observations that could be made that would falisfy evolution.
- An Ordovician dinosaur
- A bird with wings and feathers (or any other hexapod vertebrate)
- Human DNA being closer to armadillos than to primates
- Iguanas with mammary glands or lobsters with a backbone
- Plants with melanocytes
etc. etc.

I ask again, is evolution falsifiable without a time machine? Personally I believe it has already been falsified by evidence against the bizarre claim that man and chimps have a common ancestor. But evolutionism icons DIE HARD, so it will take years, even decades for evolutionists to come around (some never will) to the realization that they have nothing in common with the apes, other than our Creator.

Since "evolutionism" doesn't exist there are no "evolutionism theories". Evolution also doesn't explain the geological column and you still seem not to understand what a scientific theory is. There are bogus claims made by Creationists that are either simplistic to the point of ridiculousness (billions of dead things buried) or inane (oak trees running faster up hills than theropods).

I am pretty certain I know what a scientific theory is, and I am reasonably certain I understand evolutionary geology, and evolutionism, generally.

Yeah, it's a dumb question so I didn't see any value in responding to it. It also had nothing to do with what I wrote.

So, you don't know if mathematics is falsifiable?

How clever.

Perhaps. I didn't want to make too big a deal out of your silly linguistic rules.

Awesome. Stop peppering your responses with them and I'll stop pointing them out.

I have not made a "non-sequitur".

care to try again

A list of links is far from proof.

Quite humorous given that it's not a "belief", we have evidence, and even more humorous given that those who deny common ancestry usually have no idea what that evidence is. They just know "in their gut" that it's wrong or doesn't actually exist. To them it's just common sense that it's impossible humans and chimpanzees are related.

There is no evidence for common descent. Evolutionists could get away with making that claim when everyone believed the cell was a blob of protoplasm; but modern genetic research has rendered it harder and harder for any rational person so believe such nonsense.

Dan

 

[Bible Research Tools]

Since Miller-Urey was an experiment to test hypotheses about the origin of life it is by definition not evidence (you really need to read this article about "proof" and science ) for evolution.

The Miller-Urey experiment deceived students for decades; and possibly still is.

Peppered moths, the Darwin's finches and Archaeopteryx are all evidence for evolution.

Peppered moths and Darwin's finches are proof of a minor part of evolutionism -- microevolution -- that even a child understands. There is no proof of the serious Darwinian claim -- macroevolution.

The fossilized remains of perching birds called Archaeopteryx are not evidence of anything except there was at one time a strange-looking bird. Well, there are still strange-looking birds.

The author of that opinion piece is Casey Luskin who, until he was laid off, worked as a shill for the Discovery Institute just like Jonathan Wells.

The word "shill" is one of the labels evolutionists attach to researchers who uncover and expose their shenanigans. This is from the web-site more appropriately named "Irrational Wiki":

Casey Luskin - RationalWiki​

This is Casey's bio:

Bio of Casey Luskin - CaseyLuskin.com​

This is his announcement that he was leaving the Discovery Institute after 10 years of service:

https://evolutionnews.org/2015/12/a_big_announcem/​

Indeed. He is a Creationist, but he's not a scientist. In fact he doesn't even seem to have a profile on Google Scholar.
Profiles

You need to get out more. Casey received a MS in Earth Sciences from the University of California at San Diego, focusing on geology (emphasis on paleomagnetism).

Dan

 

[Bible Research Tools]

I already demonstrated my knowledge by bringing them up.

Are you certain your "knowledge" is up to date? This is the list you flopped out:

• - 203,000 shared endogenous retroviral insertions
• - 3,000,000+ shared transposable elements
• - a shared broken GULO gene which we also share with all other Haplorhines
• - Human chromosome 2 is a fusion of chimpanzee/LCA chromsomes 2a and b
• - MYH16 changed size of jaw muscles
• - SRGAP2C and ARHGAP11B caused our brains to have more dendrites and our neocortex to grow larger and more dense.

Now show us how any of those prove anything.

For example, your claim that Human Chr-2 is a fusion of chimpanzee's is one of the most outrageous inventions against sanity ever imagined by evolutionists. You could get away with such inane claims in the past, but real science has caught up with and surpassed that kind of foolishness.

But if you are more interested in playing childish games like this than showing you bring more to the table than vacuous rhetoric I'm going to go something more productive like telling a Star Wars fan site how great The Last Jedi was. At least they'll actually engage in conversation.

More silliness . . .

Dan

 

[Bible Research Tools]

Icons of Evolution is terrible book. NCSE rips it apart yet we're still seeing it's garbage floating around the Internet. (note the mantra like repetition and laundry list "argumentation" we're seeing - it's all just working through Wells' chapter titles)
Icons of Evolution?

For those of you who are unaware, the misnamed "National Center for Science Education" (NCSE) is presided over by an outrageous charlatan named Ken Miller. I personally recommend that you do not buy a used car from him.

Dan

 

[Bible Research Tools]

Icons of Evolution is terrible book. NCSE rips it apart yet we're still seeing it's garbage floating around the Internet. (note the mantra like repetition and laundry list "argumentation" we're seeing - it's all just working through Wells' chapter titles)
Icons of Evolution?

I almost forgot. I have the book "Icons of Evolution" by Regnery Publishing (2000), and it is an excellent book. It exposes some of the more outrageous claims made in the name of evolutionism. Wells has also written an excellent article titled "Survival of the Fakest" that you might be interested in:

http://www.discovery.org/f/12009​

Dan

 

[Bible Research Tools]

I think you know the answer to that question. I mean, unlike many Creationists, I actually know the names of these folks even if I forget their, ahem, "credentials".

The many years of research by Dr. Carl Werner, M.D., is well-documented for all to see. It is certainly worth a close look.

Dan

 

[USincognito]

It basically means the theory of evolution is baseless without a good theory on abiogenesis which it doesn't have.

1. Does that mean plate tectonics is baseless since it doesn't explain the origin of the earth or germ theory is baseless since it doesn't explain the origin of viruses and bacteria?

2. If the origin of life on earth is so important to evolution please tell us how these different origins would effect evolution.
- abiogenesis
- panspermia
- creation by God