What's new in the world of Creationism vs Evolution?

[pitabread]

I used to frequent these forums around a decade ago under a different alias. I see that some of the old regulars are still here and that some of the same ol' arguments are still getting tossed around (and I see AV1611VET is still posting endless challenge threads).

So has there been anything new or interesting cropped up in the last decade? I see AiG has actually started publishing more genomics-based material (articles like this one for example). Funny how it's taken them about a decade to start catching up to some of the real-world science. But in the end, it's the usual casting of FUD and reactionism.

Wondering if anything original or interesting has come in this time. Or is it mostly the same ol' arguments like moon dust and transitional fossils?

 

[Speedwell]

I used to frequent these forums around a decade ago under a different alias. I see that some of the old regulars are still here and that some of the same ol' arguments are still getting tossed around (and I see AV1611VET is still posting endless challenge threads).

So has there been anything new or interesting cropped up in the last decade? I see AiG has actually started publishing more genomics-based material (articles like this one for example). Funny how it's taken them about a decade to start catching up to some of the real-world science. But in the end, it's the usual casting of FUD and reactionism.

Wondering if anything original or interesting has come in this time. Or is it mostly the same ol' arguments like moon dust and transitional fossils?

Intelligent Design is still popular to a degree. The coming thing seems to be Information Theory (blatant misrepresentations of) and the notion that genetic information can only have an intelligent source.

 

[Chesterton]

Well the good news is we found an actual transitional fossil. The bad news is it created two new gaps!

 

[pitabread]

Intelligent Design is still popular to a degree. The coming thing seems to be Information Theory (blatant misrepresentations of) and the notion that genetic information can only have an intelligent source.

I remember back when all that stuff started. Do people still cite Behe, Dembski, et al? In fact, are the standard ID proponents still out there publishing stuff? Or have any new folks come into the fold?

 

[Speedwell]

I remember back when all that stuff started. Do people still cite Behe, Dembski, et al? In fact, are the standard ID proponents still out there publishing stuff? Or have any new folks come into the fold?

Are you aware of Kitzmiller v. Dover Area School District?

 

[pitabread]

Are you aware of Kitzmiller v. Dover Area School District?

Oh yes. Even wrote a paper on it for a law class.

 

[USincognito]

So has there been anything new or interesting cropped up in the last decade?

The quality of Creationist participation here has, sadly, diminished to nearly nothing. These days it's really just AV's tired antics, dad's well... being dad, and newbies joining and posting PRATTs that literally have been refuted a thousand times in this very subforum.

 

[Larniavc]

I used to frequent these forums around a decade ago under a different alias. I see that some of the old regulars are still here and that some of the same ol' arguments are still getting tossed around (and I see AV1611VET is still posting endless challenge threads).

So has there been anything new or interesting cropped up in the last decade? I see AiG has actually started publishing more genomics-based material (articles like this one for example). Funny how it's taken them about a decade to start catching up to some of the real-world science. But in the end, it's the usual casting of FUD and reactionism.

Wondering if anything original or interesting has come in this time. Or is it mostly the same ol' arguments like moon dust and transitional fossils?

No, it's basically the same.

Normally some passionate young person gets duped by a creo website posting PRATTs and for a while burns brightly with vim and verve, striving to knock science down a peg or two.

Then reality sets in, it goes quiet until the next Young Turk reads some more creo website.

 

[AV1611VET]

So has there been anything new or interesting cropped up in the last decade?

Scientists now say Earth had two moons at one time.

But, unlike Mars' moons, Mother Nature couldn't control them and now we have one.

 

[OldWiseGuy]

This validates the scripture that there is "nothing new under the sun". Christians haven't proven creation or ID, and science hasn't solved the problems of crime, war, hunger, etc.

 

[Loudmouth]

I used to frequent these forums around a decade ago under a different alias. I see that some of the old regulars are still here and that some of the same ol' arguments are still getting tossed around (and I see AV1611VET is still posting endless challenge threads).

So has there been anything new or interesting cropped up in the last decade? I see AiG has actually started publishing more genomics-based material (articles like this one for example). Funny how it's taken them about a decade to start catching up to some of the real-world science. But in the end, it's the usual casting of FUD and reactionism.

Wondering if anything original or interesting has come in this time. Or is it mostly the same ol' arguments like moon dust and transitional fossils?

There are a few that come to mind.

Behe's book "Edge of Evolution" attempts to make the IC argument in the world of genomes. In the book, Behe claims that the malaria parasite had to obtain two specific mutations in order to be resistant to chloroquine treatment. As it turns out, there are many paths for evolving chloroquine resistance outside of just those two mutations.

Douglas Axe and Ann Gauger did some experiments where they tried to support ID. What they did instead was try to refute evolution which we all know is not ID research. Anyway . . . they tried to argue that mutations could not bridge the differences between two homologous genes found in two different bacterial species. What they found is that they couldn't change one gene into the other by adding one mutation to the next. What they failed to understand is that one modern species does not evolve from another modern species. They evolve from a common ancestor. What they should have done is use a phylogenetic method to reconstruct the ancestral gene and start with that. They didn't. Therefore, their work even fails to properly test evolution, much less ID.

Yet another example that comes to mind is some work done by Dr. Jeffrey Tomkins. He tried to claim that the human and chimp genomes are actually only 88% similar. The problem is that he used an ungapped analysis which ignores indels and artificially increases the differences between homologous DNA. For example:

TCATGAGTGCCCCGTTATGG
TCATGAGTGCCCGTTATGG
ungapped analysis, 15/20 or 75%

TCATGAGTGCCCCGTTATGG
TCATGAGTGCCC-GTTATGG
gapped analysis, 19/20 or 95%

When you use Tomkins same method with the exception of a gapped analysis instead of an ungapped analysis you get the expected results of >95%.

Those are three examples that come to mind. "Edge of Evolution" may be from your previous stint here at CF, but I think the others may be new to you.

 

[AV1611VET]

... and science hasn't solved the problems of crime, war, hunger, etc.

Actually I question that ... at least from their perspective.

They have a good explanation; they just don't use it anymore for some reason.

It's called "Malthusian catastrophies."

 

[OldWiseGuy]

Actually I question that ... at least from their perspective.

They have a good explanation; they just don't use it anymore for some reason.

It's called "Malthusian catastrophies."

Perhaps they have so many scientific advances in their toolbox that no problem is too daunting anymore, not even the Malthusian catastrophe.

 

[Mike Lane]

Christians haven't proven creation or ID, and science hasn't solved the problems of crime, war, hunger, etc.

That's because most of the problems are caused by different religions.

 

[essentialsaltes]

On the legal/school front, in the US the move is toward writing laws that forbid school districts from forbidding teachers to discuss 'strengths and weaknesses' of scientific theories. While touted as academic freedom, it's pretty clear that they are intended to provide cover for anti-science views.

 

[OldWiseGuy]

That's because most of the problems are caused by different religions.

So what is science's answer?

 

[AV1611VET]

So what is science's answer?

Fight or flight.

 

[OldWiseGuy]

Fight or flight.

They can run but they can't hide.....from human nature. They even (yikes) have it themselves.

 

[Steve Petersen]

This validates the scripture that there is "nothing new under the sun". Christians haven't proven creation or ID, and science hasn't solved the problems of crime, war, hunger, etc.

Actually, great progress has been made against hunger and poverty. Recency bias prevents us from seeing it.

The Ultimate Resource 2: Julian Lincoln Simon: 9780691003818: Amazon.com: Books

 

[OldWiseGuy]

Actually, great progress has been made against hunger and poverty. Recency bias prevents us from seeing it.

The Ultimate Resource 2: Julian Lincoln Simon: 9780691003818: Amazon.com: Books

Actually Ehrlich's "population bomb" has already exploded. However, most either don't see it or are in denial of it.