The 'Macro-Micro' thing....again..

[HitchSlap]

Endless genealogies does not mean "infinite genealogies."

You cannot daisy-change cyanobacteria to man, even on paper.

So "endless genealogies" is a near perfect ... if not perfect ... description of evolution from a commoner's point of view.

It's more like grasping at straws from a logical person's point of view.

 

[CabVet]

So "endless genealogies" is a near perfect ... if not perfect ... description of evolution from a commoner's point of view.

Not really, only from the point of view of someone who has no idea what evolution is.

 

[AV1611VET]

You. Got. Nuthin'.......

And I guarantee you:

You. Got. Nuthin. As. Well.

Or you wouldn't be asking and asking and asking.

 

[AV1611VET]

Not really, only from the point of view of someone who has no idea what evolution is.

Well ... seeing as evolution wasn't solidified until after Darwin.

And seeing as how the Bible can use technospeak in a way a child can understand it, but self-professed "wise men" cannot, I'd say that's a fair statement.

And for the record, Paul didn't need to know what all evolution entailed.

These guys didn't always understand what they were writing about.

In fact, the sixth dispensation (Grace or Church Age) that we are currently under, wasn't even understood by the angels.

1 Peter 1:12 Unto whom it was revealed, that not unto themselves, but unto us they did minister the things, which are now reported unto you by them that have preached the gospel unto you with the Holy Ghost sent down from heaven; which things the angels desire to look into.

That's because the Church Age was treated as a mystery.

Note here where Isaiah makes a prophecy that jumps from the 5th dispensation (Law) ... right over the 6th dispensation (Grace) ... and into the 7th dispensation (Kingdom).

Isaiah 61:1 The Spirit of the Lord GOD is upon me; because the LORD hath anointed me to preach good tidings unto the meek; he hath sent me to bind up the brokenhearted, to proclaim liberty to the captives, and the opening of the prison to them that are bound;
Isaiah 61:2 To proclaim the acceptable year of the LORD, [JUMP] and the day of vengeance of our God; to comfort all that mourn;

Now notice, when Jesus quotes this passage, where He stops.

Luke 4:17 And there was delivered unto him the book of the prophet Esaias. And when he had opened the book, he found the place where it was written,
Luke 4:18 The Spirit of the Lord is upon me, because he hath anointed me to preach the gospel to the poor; he hath sent me to heal the brokenhearted, to preach deliverance to the captives, and recovering of sight to the blind, to set at liberty them that are bruised,
Luke 4:19 To preach the acceptable year of the Lord. [← NOTE THE PERIOD]
Luke 4:20 And he closed the book, and he gave it again to the minister, and sat down. And the eyes of all them that were in the synagogue were fastened on him.
Luke 4:21 And he began to say unto them, This day is this scripture fulfilled in your ears.

Notice where He closed the book?

At the comma.

This is because there was to be a period of time between preaching the acceptable year of the LORD and the day of vengeance of our God.

All this boils down to:

Evolution can take a hike.

 

[TheBear]

Endless genealogies does not mean "infinite genealogies."

You cannot daisy-change cyanobacteria to man, even on paper.

So "endless genealogies" is a near perfect ... if not perfect ... description of evolution from a commoner's point of view.

Genealogies have origins, not "endless".

You can't have it both ways. Start thinking for yourself!

 

[Strathos]

The thing is ... did He?

I contend He didn't.

And He made that very clear in Genesis 1.

And I contend that He did. Reading certain passages the same you read Genesis 1 leads to the conclusion of geocentrism. The Bible wasn't intended as a science book.

 

[PsychoSarah]

And I guarantee you:

You. Got. Nuthin. As. Well.

Or you wouldn't be asking and asking and asking.

We aren't asking about evolution as we are asking why people think it doesn't work. Has there been a question about evolution asked by you that didn't get an answer? Just because you don't consider than answer doesn't mean it isn't a valid one. You are the one asking all the questions about biology and then making arguments based off of a lack of completely understanding how genes and other biological processes work.

 

[AV1611VET]

You are the one asking all the questions about biology ...

That's news to me.

 

[PsychoSarah]

That's news to me.

Apparently.

 

[MarkT]

It migh help to have real data to work with. Here is a section of DNA from the human genome:

CCGGGCCCTGTGCACCTTGGGTCTCATCATGGGCACCTTCACTCTCTGCTGGTTGCCCTTCTTTCTGGCCA
ACGTGCTGCGCGCCCTGGGGGGCCCCTCTCTAGTCCCGGGCCCGGCTTTCCTTGCCCTGAACTGGCTAGGT
TATGCCAATTCTGCCTTCAACCCGCTCATCTACTGCCGCAGCCCGGACTTTCGCAGCGCCTTCCGCCGTCT
TCTGTGCCGCTGCGGCCGTCGCCTGCCTCCGGAGCCCTGCGCCGCCGCCCGCCCGGCCCTCTTCCCCTCGG
GCGTTCCTGCGGCCCGGAGCAGCCCAGCGCAGCCCAGGCTTTGCCAACGGCTCGACGGGTAGGTAACCGGG
GCAGAGGGACCGGCGGCTCAGGGTCGGGAAGCATGCGATGTGTCCGTGGGTCAACTTTTTGAGTGTGGAGT
TTATTAAGAGAAGGTGGGATGGCTTTGCTTGGAGAGAAAAGGGAACGAGGAGTAGCGAACCAAAATGGGAC
CCAGGGTCCTTTTCTTTCCGGATCCAGTCACTAGGGTAGAAGCAAAGGAGGGCGAGCGGGCCGTCGTTCCT
CACCCAAGGACCCAAGGTGCGCCACCGGAAAGCGCTGCGGTGTCCCGAGGACTCTCGCCTCGCCTGGTCGG
CTTTAGGGATTTTTTTTTTTTTTAAATAGAGACAGGGTTTCGTCTCTGTCGCCCACGCGGGAATGCAGTGG
CGCGATCTCAGCTCACTGCAGTCTTGAACTCCTGGCTCCTGGGCTCAAGCGATCCTCCCACCTCAGCCTCC
TGAGTATCTGGGACTACAGGCGAGCCCCACCAATCCCAGCTATTTTTAAAATTTCTTGTAGAGATGGGGTC
TTGCTATGTTGCCCAGGCTTGTCTTGAACTTCTGGCCTCAAGTGATCCTTCTGCCTCAGCCTTCCAAAGCA
TTAGGATTACAGGCCGGAGCCAGGGCGCCGGGTCGGCTCTAGTTTTGGTTTTCCAGC

Perhaps someone can tell us which of those bases can not be changed.

Here is a screen cap from a BLAST search I did. The query is human DNA and the subject is chimp DNA. As you can see, there was a match for 409 out of 420 bases, for 97% similarity (attached pic). I would like someone to tell us which of those differences could not have been produced by a microevolutionary mechanism.

This is similar to an alchemist claiming lead can be turned into gold. If you can do it, then prove it.

 

[Loudmouth]

This is similar to an alchemist claiming lead can be turned into gold. If you can do it, then prove it.

We have observed every type of mutation including substitutions of every base to another base, deletions, insertions, and recombination events. We have observed lead turning into gold.

Are you saying that bases in every genome are immune to mutation?

 

[MarkT]

We have observed every type of mutation including substitutions of every base to another base, deletions, insertions, and recombination events. We have observed lead turning into gold.

Are you saying that bases in every genome are immune to mutation?

You asked which of these bases cannot be changed, referring to the human genome. Are you saying you can change a human into a chimp?

 

[Subduction Zone]

You asked which of these bases cannot be changed, referring to the human genome. Are you saying you can change a human into a chimp?

No, evolution affects populations not individuals and it is a one way street.

For a group of humans to "evolve into chimps" would require a false goal and the only goal of evolution is survival. Now given enough time and the right conditions a population of humans could evolve to a species that looked similar to a chimpanzee, but it would still be more closely related to other humans than other actual chimpanzees.

 

[Justatruthseeker]

Those who flatly deny the explanations provided by evolutionary theory frequently centre their argument around the claim that 'microevolution'/"variation within kinds"/adaptation occurs, but that 'macroevolution', or the descent of species as described by the theory cannot.

Fine...I want someone who makes those assertions to explain to me the biological mechanisms which cause this to come about. I don't want to hear that "god prevents it", or some other supernatural excuse...after all, if you're going to invoke magical explanations, then anything can be claimed.

No, I want some clear cut biological reason as to why it is possible for species to adapt to 'this point, but no further'....

Good question, one to which science has no answer. Just as they have no answer as to why mutation, when it occurs beneficially (about 40,000:1 for plants and about 400,000:1 for animals), always reaches a saturation point and will not then produce any new variations, and is incapable of explaining the addition of new genetic material.

http://www.weloennig.de/Loennig-Long-Version-of-Law-of-Recurrent-Variation.pdf


So I don't want to hear nature did it, or mutations just do it. I want to hear a valid scientific explanation as to why you ignore mutation research results for the last 50+ years and claim it has produced all the existing life from simple life, contrary to that research????????

 

[PsychoSarah]

This is similar to an alchemist claiming lead can be turned into gold. If you can do it, then prove it.

Actually, some bored scientists (because this is the kind of stuff smart people do when they have free time) did chemically turn lead into gold not so long ago. Seriously, look it up. Of course, the process cost more than the gold was worth, but that wasn't really the point.

 

[PsychoSarah]

You asked which of these bases cannot be changed, referring to the human genome. Are you saying you can change a human into a chimp?

A living adult human? No. An unborn zygote? Possibly, we have made glowing pigs and mice by inserting firefly genes into them, so maybe one day not too far in the future we would be capable of that. Now why anyone would do such a clearly unethical act is another story.

 

[Loudmouth]

Good question, one to which science has no answer. Just as they have no answer as to why mutation, when it occurs beneficially (about 40,000:1 for plants and about 400,000:1 for animals), always reaches a saturation point and will not then produce any new variations, and is incapable of explaining the addition of new genetic material.

http://www.weloennig.de/Loennig-Long-Version-of-Law-of-Recurrent-Variation.pdf

Your study is falsified by the real world where new variations have been produced for 3.5 billion years now. We observe mutations producing new phenotypes that become dominant.

So I don't want to hear nature did it, or mutations just do it.

We already know that you are averse to the truth, so no wonder that you don't want to hear the facts.

I want to hear a valid scientific explanation as to why you ignore mutation research results for the last 50+ years and claim it has produced all the existing life from simple life, contrary to that research????????

You should ask yourself that. You should also start reading some real science instead of that hack paper.

 

[Loudmouth]

You asked which of these bases cannot be changed, referring to the human genome. Are you saying you can change a human into a chimp?

I am asking which of the differences between humans and chimps could not be produced by the observed mechanisms of mutation. Do you have an answer for that?

 

[Dizredux]

http://www.weloennig.de/Loennig-Long-Version-of-Law-of-Recurrent-Variation.pdf

You keep bringing this article up so I looked Lonnig up and there does not seem to be much on him except in ID circles. And while he does appear to be a legitimate scientist he does not appear to be a major player.

I looked up the article, "Mutation breeding, evolution, and the law of recurrent variation" on Google Scholar and he showed 5 cites since 2005 which does not indicate much impact.

So I have to ask has his work been replicated and what do others in his field think about his work and conclusions? Without more or more recent information I would caution readers to be hesitant to take the article as meaning a whole lot.

Dizredux

 

[biggles53]

You asked which of these bases cannot be changed, referring to the human genome. Are you saying you can change a human into a chimp?

Which of the bases cannot be changed.....and why...?