The 'Macro-Micro' thing....again..

[biggles53]

Those who flatly deny the explanations provided by evolutionary theory frequently centre their argument around the claim that 'microevolution'/"variation within kinds"/adaptation occurs, but that 'macroevolution', or the descent of species as described by the theory cannot.

Fine...I want someone who makes those assertions to explain to me the biological mechanisms which cause this to come about. I don't want to hear that "god prevents it", or some other supernatural excuse...after all, if you're going to invoke magical explanations, then anything can be claimed.

No, I want some clear cut biological reason as to why it is possible for species to adapt to 'this point, but no further'....

 

[Loudmouth]

It migh help to have real data to work with. Here is a section of DNA from the human genome:

CCGGGCCCTGTGCACCTTGGGTCTCATCATGGGCACCTTCACTCTCTGCTGGTTGCCCTTCTTTCTGGCCA
ACGTGCTGCGCGCCCTGGGGGGCCCCTCTCTAGTCCCGGGCCCGGCTTTCCTTGCCCTGAACTGGCTAGGT
TATGCCAATTCTGCCTTCAACCCGCTCATCTACTGCCGCAGCCCGGACTTTCGCAGCGCCTTCCGCCGTCT
TCTGTGCCGCTGCGGCCGTCGCCTGCCTCCGGAGCCCTGCGCCGCCGCCCGCCCGGCCCTCTTCCCCTCGG
GCGTTCCTGCGGCCCGGAGCAGCCCAGCGCAGCCCAGGCTTTGCCAACGGCTCGACGGGTAGGTAACCGGG
GCAGAGGGACCGGCGGCTCAGGGTCGGGAAGCATGCGATGTGTCCGTGGGTCAACTTTTTGAGTGTGGAGT
TTATTAAGAGAAGGTGGGATGGCTTTGCTTGGAGAGAAAAGGGAACGAGGAGTAGCGAACCAAAATGGGAC
CCAGGGTCCTTTTCTTTCCGGATCCAGTCACTAGGGTAGAAGCAAAGGAGGGCGAGCGGGCCGTCGTTCCT
CACCCAAGGACCCAAGGTGCGCCACCGGAAAGCGCTGCGGTGTCCCGAGGACTCTCGCCTCGCCTGGTCGG
CTTTAGGGATTTTTTTTTTTTTTAAATAGAGACAGGGTTTCGTCTCTGTCGCCCACGCGGGAATGCAGTGG
CGCGATCTCAGCTCACTGCAGTCTTGAACTCCTGGCTCCTGGGCTCAAGCGATCCTCCCACCTCAGCCTCC
TGAGTATCTGGGACTACAGGCGAGCCCCACCAATCCCAGCTATTTTTAAAATTTCTTGTAGAGATGGGGTC
TTGCTATGTTGCCCAGGCTTGTCTTGAACTTCTGGCCTCAAGTGATCCTTCTGCCTCAGCCTTCCAAAGCA
TTAGGATTACAGGCCGGAGCCAGGGCGCCGGGTCGGCTCTAGTTTTGGTTTTCCAGC

Perhaps someone can tell us which of those bases can not be changed.

 

[Sayre]

All your base are belong to us.

 

[AV1611VET]

No, I want some clear cut biological reason as to why it is possible for species to adapt to 'this point, but no further'....

Let's simplify this.

Let's assume macroevolution can occur, and that there is no physical barrier stopping it.

In that case, I submit a non-biological reason why it is possible for a species to adapt to 'this point, but no further':

[Lack of enough] time.

 

[Loudmouth]

Here is a screen cap from a BLAST search I did. The query is human DNA and the subject is chimp DNA. As you can see, there was a match for 409 out of 420 bases, for 97% similarity (attached pic). I would like someone to tell us which of those differences could not have been produced by a microevolutionary mechanism.

 

[Loudmouth]

Let's simplify this.

Let's assume macroevolution can occur, and that there is no physical barrier stopping it.

In that case, I submit a non-biological reason why it is possible for a species to adapt to 'this point, but no further':

[Lack of enough] time.

Please explain why 4.5 billion years is insufficient.

 

[AV1611VET]

Please explain why 4.5 billion years is insufficient.

I never said it wasn't.

 

[Loudmouth]

I never said it wasn't.

"In that case, I submit a non-biological reason why it is possible for a species to adapt to 'this point, but no further':

[Lack of enough] time. "--AV1611VET

 

[AV1611VET]

"In that case, I submit a non-biological reason why it is possible for a species to adapt to 'this point, but no further':

[Lack of enough] time. "--AV1611VET

I know what I wrote.

The universe has only been in existence for 6000 years.

That comes out to "not enough time."

 

[Loudmouth]

The universe has only been in existence for 6000 years.

That is false. The age of the universe is around 13 billion years. Planet formation began 4.5 billion years. Life showed up on Earth around 3.5 billion years ago. Those are all backed by facts.

If you would like to present some facts to support your claims, go ahead. However, it seems that you have left reality far behind, so we won't be expecting references to any facts from you. Do you really thing that your fantasies have any bearing on reality?

 

[AV1611VET]

That is false. The age of the universe is around 13 billion years. Planet formation began 4.5 billion years. Life showed up on Earth around 3.5 billion years ago. Those are all backed by facts.

I don't care about all that.

I am stating that a universe that has only been in existence for 6000 years would be a viable non-biological barrier to evolution.

Are you telling me you don't agree with that???

 

[Loudmouth]

I don't care about all that.

If you don't care about the facts then you probably shouldn't be involved in a discussion based on science.

I am stating that a universe that has only been in existence for 6000 years would be a viable non-biological barrier to evolution.

If pigs had wings they could fly.

Are you ready to talk about the real world where life had 3.5 billion years to evolve?

 

[AirPo]

It migh help to have real data to work with. Here is a section of DNA from the human genome:

CCGGGCCCTGTGCACCTTGGGTCTCATCATGGGCACCTTCACTCTCTGCTGGTTGCCCTTCTTTCTGGCCA
ACGTGCTGCGCGCCCTGGGGGGCCCCTCTCTAGTCCCGGGCCCGGCTTTCCTTGCCCTGAACTGGCTAGGT
TATGCCAATTCTGCCTTCAACCCGCTCATCTACTGCCGCAGCCCGGACTTTCGCAGCGCCTTCCGCCGTCT
TCTGTGCCGCTGCGGCCGTCGCCTGCCTCCGGAGCCCTGCGCCGCCGCCCGCCCGGCCCTCTTCCCCTCGG
GCGTTCCTGCGGCCCGGAGCAGCCCAGCGCAGCCCAGGCTTTGCCAACGGCTCGACGGGTAGGTAACCGGG
GCAGAGGGACCGGCGGCTCAGGGTCGGGAAGCATGCGATGTGTCCGTGGGTCAACTTTTTGAGTGTGGAGT
TTATTAAGAGAAGGTGGGATGGCTTTGCTTGGAGAGAAAAGGGAACGAGGAGTAGCGAACCAAAATGGGAC
CCAGGGTCCTTTTCTTTCCGGATCCAGTCACTAGGGTAGAAGCAAAGGAGGGCGAGCGGGCCGTCGTTCCT
CACCCAAGGACCCAAGGTGCGCCACCGGAAAGCGCTGCGGTGTCCCGAGGACTCTCGCCTCGCCTGGTCGG
CTTTAGGGATTTTTTTTTTTTTTAAATAGAGACAGGGTTTCGTCTCTGTCGCCCACGCGGGAATGCAGTGG
CGCGATCTCAGCTCACTGCAGTCTTGAACTCCTGGCTCCTGGGCTCAAGCGATCCTCCCACCTCAGCCTCC
TGAGTATCTGGGACTACAGGCGAGCCCCACCAATCCCAGCTATTTTTAAAATTTCTTGTAGAGATGGGGTC
TTGCTATGTTGCCCAGGCTTGTCTTGAACTTCTGGCCTCAAGTGATCCTTCTGCCTCAGCCTTCCAAAGCA
TTAGGATTACAGGCCGGAGCCAGGGCGCCGGGTCGGCTCTAGTTTTGGTTTTCCAGC

Perhaps someone can tell us which of those bases can not be changed.

That is tricky on the eyes!

 

[Loudmouth]

That is tricky on the eyes!

In the old days, we would receive sequencing runs as paper hard copies. We would read the bases aloud while the other person checked it against a database. If you think it is hard on the eyes, it is even harder on the ears and tongue to go through thousands of bases of DNA that way.

 

[Smidlee]

Fine...I want someone who makes those assertions to explain to me the biological mechanisms which cause this to come about.

I think what you are looking for are "developmental gene regulatory networks " (dGRN).

Here's a quote from biologist Eric Davidson "There is always an observable consequence if a dGRN sub-circuit is interrupted. Since these consequences are always catastrophically bad, flexibility is minimal, and since the sub-circuits are all interconnected, the whole network partakes of the quality that there is only one way for things to work. And indeed the embryos of each species develop in only one way." (Eric H. Davidson, "Evolutionary Bio-science as Regulatory Systems Biology," Developmental Biology, 357 (September 1, 2011): 40.)

Evolutionist Marshall believes dGRN had to be a lot more flexible in the past since this has to be so in order for evolution to be true.

 

[biggles53]

Let's simplify this.

Let's assume macroevolution can occur, and that there is no physical barrier stopping it.

In that case, I submit a non-biological reason why it is possible for a species to adapt to 'this point, but no further':

[Lack of enough] time.

Just 4 posts in before you attempt the derail...

That's pretty good, even for you....

Now, answer the question if you can, or kindly butt out....

 

[biggles53]

I think what you are looking for are "developmental gene regulatory networks " (dGRN).

Here's a quote from biologist Eric Davidson "There is always an observable consequence if a dGRN sub-circuit is interrupted. Since these consequences are always catastrophically bad, flexibility is minimal, and since the sub-circuits are all interconnected, the whole network partakes of the quality that there is only one way for things to work. And indeed the embryos of each species develop in only one way." (Eric H. Davidson, "Evolutionary Bio-science as Regulatory Systems Biology," Developmental Biology, 357 (September 1, 2011): 40.)

Evolutionist Marshall believes dGRN had to be a lot more flexible in the past since this has to be so in order for evolution to be true.

I'm not a professional biologist, so would defer to someone like loudmouth or sfe, but are you talking about embryological development..? What does that have to do with the process of mutation that brings about change in the genome..? I presume that, as most creationists accept, you agree that mutations occur and that this brings about change in the characteristics of species...? Then where is the no-go boundary that prevents subsequent mutations/changes from occurring....?

 

[Chany]

I don't care about all that.

I am stating that a universe that has only been in existence for 6000 years would be a viable non-biological barrier to evolution.

Are you telling me you don't agree with that???

Actually, evolution, in and of itself, would still hold true in the universe as long as there are populations whose alleles shift around from generation to generation. It doesn't matter if the creatures materialized out of nothing; evolution would still occur.

 

[biggles53]

I don't care about all that.

I am stating that a universe that has only been in existence for 6000 years would be a viable non-biological barrier to evolution.

Are you telling me you don't agree with that???

Except I didn't ask for NON-biological barriers....I asked for biological ones...

But you know that quite well don't you...?

 

[Sayre]

I could have sworn that in prior threads, AV said that the universe was 14 billion years old but that the earth has only revolved around the sun 6000 times.