Science Says NO to Evolution Theory!

[Loudmouth]

and about ayala:
"we would never have guessed stasis from population dynamics, but i now believe what the paleontologists say, that small changes do not accumulate"
-

In which article written by Ayala can we find this quote?

 

[Loudmouth]

yes indeed, boyce is another educated fool lying his butt off about evolution.
:rolleyes.

and you wonder why people have serious questions about this stuff.

Why don't you cite articles written by Ayala?

 

[FollowerOfJesus]

The ID folks say: well, it looks like a design, therefore it must have been done by a designer. And some how they call dating geologic strata circular reasoning. Zeeeeeshhhhhhhh!

Interesting, when did questioning the geological strata become part of ID? ID is more concerned with the age old question of which came first matter or information, can information be produced by unguided random process or is there an intelligence behind it? Anyone who says they know the answer needs to publish and get in the Noble Prize line.

Every know example of intelligence is created by a conscious, there are those who argue this is not true by redefining intelligence in terms that allow for non-intelligence to be considered intelligence. For example, a cyclical repeating process, this is not intelligence; intelligence, is more like a book or computer program where the variation of characters produce complex ideas or behavior that is not just the cyclical repetition of the characters of the language.

 

[Loudmouth]

Interesting, when did questioning the geological strata become part of ID? ID is more concerned with the age old question of which came first matter or information, can information be produced by unguided random process or is there an intelligence behind it? Anyone who says they know the answer needs to publish and get in the Noble Prize line.

The problem is that no one in the ID echo chamber can define information in a way that can be used to measure information in DNA, or in anything for that matter. For example, what is the information content of this stretch of DNA sequence? Which mutations would increase information in that sequence?

CGGTGTTGTCCTCATAGTTTGGGCATGTTTCCCTTGTAGGTGTGAAACCACTTAGCTTCGCGCCGTAGTCCTAAAGGAAAACCTATGGACTTTGTTTCGGGTAGCACCAGGAATCTGAACCATGTGAATGTGGACGTGGCGCGCGTACACCTTAATCTCCGGTTCATGCTAGGGATGTGGCTGCATGCTACGTTGACACA

Every know example of intelligence is created by a conscious, there are those who argue this is not true by redefining intelligence in terms that allow for non-intelligence to be considered intelligence. For example, a cyclical repeating process, this is not intelligence; intelligence, is more like a book or computer program where the variation of characters produce complex ideas or behavior that is not just the cyclical repetition of the characters of the language.

What happens is that you ignore all of the natural processes that produce the very things you are talking about.

 

[RickG]

Interesting, when did questioning the geological strata become part of ID?

It was an analogy.

 

[whois]

In which article written by Ayala can we find this quote?

the following is from a conference hosted in chicago, and penned by roger lewin.
of course, he was just another award winning science journalist that all of a sudden decided to bad mouth evolution.
:more rolling of the eyes.

The absence of transitional forms be- tween established species has tradition- ally been explained as a fault of an im- perfect record, an argument first advanced by Charles Darwin. The accumulation of sediments and the entrapment and fossilization of animal bones is, at best, a capricious process: as a result, geologists are familiar with the difficulties of reconstructing past events. According to the traditional position, therefore, if sedimentation and fossilization did indeed encapsulate a complete record of prehistory, then it would reveal the postulated transitional organisms. But it isn't and it doesn't.

"Certainly the record is poor," admitted Gould, "but the jerkiness you see is not the result of gaps, it is the consequence of the jerky mode of evolutionary change." To the evident frustration of many people at the meeting, a large proportion of the contributions were characterized more by description and assertion than by the presentation of data.

In a generous admission Francisco Ayala, a major figure in propounding the Modern Synthesis in the United States, said: "We would not have predicted stasis from population genetics, but I am now convinced from 884 what the paleontologists say that small changes do not accumulate."
-Science, vol. 210 no. 4472 pp: 883-887

 

[FollowerOfJesus]

What happens is that you ignore all of the natural processes that produce the very things you are talking about.

Ignoring the insult of "echo chamber", please name one.

 

[FollowerOfJesus]

If SETI detects information, the theory is that we have detected intelligence in the universe, not so with ID? We have detected information in the cell; though, that is not a signature of intelligence?

 

[RickG]

the following is from a conference hosted in chicago, and penned by roger lewin.
of course, he was just another award winning science journalist that all of a sudden decided to bad mouth evolution.
:more rolling of the eyes.

Key word: journalist

Journalist write opinions about things. That's their expertise, writing opinions. They don't do science because they are not trained in it. They wouldn't know a soxhlet from a bunsen burner, much less what they are used for.

 

[whois]

Key word: journalist

Journalist write opinions about things. That's their expertise, writing opinions. They don't do science because they are not trained in it. They wouldn't know a soxhlet from a bunsen burner, much less what they are used for.

i have no clue what a soxhlet is, but it sure didn't stop me from quoting you, word for word.
it's really amazing how science writers brains just fall out of their craniums when discussing evolution.
it's equally amazing that science (the magazine) employs such people.
magazines such as science did not get respect by employing shoddy rag writers you know.

 

[whois]

Key word: journalist

Journalist write opinions about things. That's their expertise, writing opinions. They don't do science because they are not trained in it. They wouldn't know a soxhlet from a bunsen burner, much less what they are used for.

i have no clue what a soxhlet is, but it sure didn't stop me from quoting you, word for word.
it's really amazing how science writers brains just fall out of their craniums when discussing evolution.
it's equally amazing that science (the magazine) employs such people.
magazines such as science did not get respect by employing shoddy rag writers you know.

 

[The Cadet]

Interesting, when did questioning the geological strata become part of ID? ID is more concerned with the age old question of which came first matter or information,

...Matter. Because given how information is defined by information theory, you cannot have information without a physical or abstract substrate of some kind. That was easy. Next!

can information be produced by unguided random process

No! But then, neither can the number "2". Because information has been well-defined by information theory and it is an abstraction.

Anyone who says they know the answer needs to publish and get in the Noble Prize line.

...But the answers have been known since 1948, when Claude Shannon published his seminal work, grounding the field of Information Theory. Unless ID is using a completely different definition of "information" in which case I'd like to know what they mean and why they would use a word which already has both a very specific scientific meaning and a very vague colloquial meaning!

Every know example of intelligence is created by a conscious

...But of course, by this definition, information is necessarily created by a consciousness because it is abstract. And in this definition, intelligence is not "out there". It's something we read into something. It's like if I refer to a "2" - that's an abstract. I'm not appealing to some literal entity somewhere, I'm creating a mathematical abstraction based either on set theory or on counting objects and turning the adjective into a noun.

I strongly recommend you read these posts:

http://www.christianforums.com/threads/the-role-of-information.7898832/#post-68358825

Spoiler: the most important bit

A quick addendum for those wondering about examples like words on a page. I often hear this example brought up to show that we can recognize inherent information, or that the information is somehow inherent to the object. It's wrong. The trick with words on a page is that we have certain shared conventions. We all agree that the word "table" generally refers to a piece of furniture with certain characteristics. And we all agree that the symbols that represent "table" have a certain form. So when we write those symbols down on a piece of paper, we are essentially crafting a string which is designed to be read a certain way. Then, when other people who understand these conventions find this paper, they recognize that they have to decode it in a certain way in order to get the meaning. However! To someone with no knowledge of these conventions,a piece of paper with the ink markings that spell out "table" is as meaningless as a rock with an odd shape! The information is not inherent. We read the information into the object, and we can craft objects that intentionally invoke a certain shared coding and which other people should recognize as such. This is so second-nature to us with our education and universal literacy that we rarely stop to think about it too hard.

http://www.christianforums.com/threads/the-role-of-information.7898832/#post-68366167

Spoiler: the important bit

Whenever someone reads your message, they are creating the information. This is quite counterintuitive, but what you have to understand is that you crafted a certain pattern with the intent of having other people read it. When they read it, they see english, and know that they have to decode it a certain way.

This is no different from a society that sends messages by arranging the atoms in rocks a certain way - they would find certain pebbles (that we would find absolutely nothing intriguing about) to be vastly interesting for the purpose of conveying messages. But the information is not inherent to the pebble. They impose it onto the pebble. Just like the information is not inherent to the pattern of the chalk - we impose it on to the chalk.

And this is the key. Your writing was made with specific goal of having a certain "cipher" imposed upon it. For people who don't know how to decode it, it's worthless - just more background noise, as meaningful as the order of drops in a rainstorm or the particular defects in a tile roof.

 

[RickG]

i have no clue what a soxhlet is, but it sure didn't stop me from quoting you, word for word.
it's really amazing how science writers brains just fall out of their craniums when discussing evolution.
it's equally amazing that science (the magazine) employs such people.
magazines such as science did not get respect by employing shoddy rag writers you know.

The primary objective of journalist is to be recognized for their work (writing, reporting, etc.). The way they accomplish that is to sensationalize or latch on to controversy. We see media reports of new scientific research and findings all the time. With little exception, those stories focus on certain aspects of the story and ignore other very important facts, quite often giving the wrong impression concerning the science. One such story surfaced a year or so ago when vast amounts of water was recognized to be in the earth's mantle of which the volume was greater than the oceans. Boy, did the creationists jump on that making all kinds of absolutely crazy claims concerning Noah's flood.

 

[Loudmouth]

the following is from a conference hosted in chicago, and penned by roger lewin.

I am asking for articles penned by Ayala. Was I not clear?

 

[Loudmouth]

If SETI detects information, the theory is that we have detected intelligence in the universe, not so with ID?

What are SETI's criteria for detecting information? How do those criteria apply to biology?

We have detected information in the cell; though, that is not a signature of intelligence?

Any particle interaction produces information. A water molecule being hit by a photon produces information. How is that a product of intelligence?

 

[Loudmouth]

Ignoring the insult of "echo chamber", please name one.

The simple freezing of water produces complex information.

All of this complex information is produced by ordinary laws of physics without any input of intelligence.

 

[Oncedeceived]

The simple freezing of water produces complex information.

All of this complex information is produced by ordinary laws of physics without any input of intelligence.

How are you defining information and how is this complex information?

 

[FollowerOfJesus]

...Matter.

And this is the key. Your writing was made with specific goal of having a certain "cipher" imposed upon it. For people who don't know how to decode it, it's worthless - just more background noise, as meaningful as the order of drops in a rainstorm or the particular defects in a tile roof.

Matter, not a given; though, based on your world view, I get it.

The, it only matters to those who understand the coding, analogy is interesting. I would add that the information in the cell is legible to the processes that count, that of replication. We are the outsiders who are learning the language, this is what ID is all about, learning the language, and the engineering process and how to exploit what we learn about this information and the engineering processes to further science.

 

[whois]

The primary objective of journalist is to be recognized for their work (writing, reporting, etc.). The way they accomplish that is to sensationalize or latch on to controversy. We see media reports of new scientific research and findings all the time.

we are talking about a well respected science source here, not the national enquirer.

 

[Loudmouth]

we are talking about a well respected science source here, not the national enquirer.

Why can't you quote Ayala himself?