If you want kids to learn creation science, show how you'd teach it.

[Beastt]

I showed you how to correctly interpret the information given.

No, you showed me your subjective opinion of how to correctly interpret the information. You've never demonstrated why your interpretation is more correct than any other.

Yes, 'very good' is substandard to a perfect entity - unless He operates on a higher vocabulary than we do.

The term "higher vocabulary", is, like many terms tossed out in such discussions, completely meaningless. What are you trying to say; "larger vocabulary", "more advanced vocabulary", "different vocabulary"? Use terms that have a meaning instead of making up terms by connecting words which together signify nothing specific. If you're just trying to railroad your way through the discussion, I can assure you, it will be easier to just admit right here that you don't understand the construct you're attempting to present.

I'm not interested in its current state of decay; its output is sufficient enough.

If you don't care about the entropy, why do you keep talking about it? And the question remains the same because you still haven't provided an answer. You've only attempted to dodge the question. How do you determine the output and how that relates to the genetics themselves?

By what it produced.

The way you keep starting to present an answer but never actually do makes me suspect that you have no clue what it is you're attempting to suggest. Let's use a hyena and a cheetah as examples. Which has the genes with the least decay? Which has the most? How do you determine this?

The result of its output (viz. coyote, dog, wolf, or dingo) determines it level of decay.

You're still just trying to dodge the question. I'll tell you right now, AV1611VET, it's not going to work. I tend to become somewhat irritated when people pursue such dishonesty and then attempt to tap-dance their way out of answering the relevant questions. I'm going to continue to pursue this issue so you'd better either admit that you haven't the slightest idea what it is you're talking about, or start coming up with some answers. I tend to be rather tenacious when people attempt such forms of dishonesty and insincerity.

By amount of information encoded, and how much that information is "jammed" or "interfered" with.

How do you determine this? (Clue: "By the output" doesn't answer the question.)

LOL

Yeah, it's starting to look like any such request is laughable. But I intend to give you every benefit of doubt. I still want you to at least try to answer the question. When you can't provide a meaningful and accurate answer, I ask that you learn from that. Your conclusions are heavily flawed and inapplicable. I hope you take note of that.

 

[shernren]

AV1611VET, if you really know so much about "genetic entropy", you should be able to give me a formula that computes the genetic entropy of a given genome. But here's a more fundamental question for you: what is the unit of genetic entropy?

 

[Mocca]

If I were to teach about creation "science" I'd teach about common fallacies and propoganda techniques used by creation scientists, and things to watch out for. Of course, I'm not specifically targeting creation science when I'd do so, because logical fallacies and propoganda techniques apply to a lot of things, but it's an important thing to know, and is strongly linked with creation science.

 

[AV1611VET]

So then your beliefs have nothing to do with what is or isn't...

Correct --- my faith lies in I AM --- not the "what is".

...it's just all about what you want to believe or want to disbelieve?

No --- that's emotionalism --- my faith is based on research and personal conviction.

Science without God is reality.

Reality --- as we know it --- is about to change when this dispensation ends.

Continued adherance to that which cannot be demonstrated is bondage.

So we were in bondage to Pluto for 76 years?

 

[Chalnoth]

Dude, continually bringing Pluto up just displays your own ignorance.

 

[AV1611VET]

Information itself has no mass. But that information must be stored in a physical form. That physical form does have mass. Why do you think hard drive storage has a physical limit?

Ya --- and the hard drive is supported by mass --- etc.

But the information itself is not subject to entropy. Where did information come from, and how is it increasing exponentially?

That's because you first have to demonstrate the addition of information.

Huh? This has to be demonstrated before its source can be located?

Tell me which of these lines contains the most information.

CAACCCCGATACATCGATACATACCCCGCACCCCCAAGAACGGACGAC ->
CTATAGAAATACATCGATGAATGAAGAACTAACGTTCTATCTCACTAT

or​

ATAAATACATAAATAAATAAATAAATAAATACATAAATACATAAATAC ->
ATAAATACATACATAAATAAATAAATACATACATAAATAAATAAATAC

I don't know --- my guess would be Line 1 --- since it has a -G-.

You gave me what you presented as a guess. I wanted clearly defined properties just like biology must use in order to classify animals. If you have no definitive system, then the word "kind" is pretty much meaningless.

You're not going to get that in a 6-week course called Biblical Earth Creation. I'm not going to go into detail on taxonomy and the like.

I can only base my impression upon what you can or can't provide. If you think an accurate classification system can rely upon whims and guesses, then I have little choice but to determine that you are woefully short of holding a working understanding of the subject you seem to feel qualified to teach to children.

No problem there --- you wanted a definition --- you got a definition; you wanted an example --- you got two examples (one easy + the hardest one on record).

If those aren't good enough, and you challenged me in class on them --- I'd fail you in a heartbeat.

What new information do you feel is present in the classification of "kinds"?

This isn't comparative science --- again it's Biblical Earth Creation.

How can genetics be deteriorating, and at the same time be gaining new information?

I don't know --- but where that information is coming from is my concern. Once again though, I believe it is losing information, not gaining information.

 

[birdan]

So we were in bondage to Pluto for 76 years?

You really seem to have a fixation with Pluto. From the lack of depth and content of your posts I would have guessed you were fixated with the 7th planet.

 

[AV1611VET]

Billions. So what?

I would teach that this invalidates Evolution - as the Earth has only been in existence 6000 years.

Why do you think we can build solar power generators? They do nothing but sit in place, and yet we can get energy from them. This is the basis of most life on the planet (thermal vents and things support some small amount of life).

The whole point of entropy is that there's coming a time when there will be no more Sun, because the universe is going to wind down to one uniform temperature.

 

[AV1611VET]

AV1611VET, if you really know so much about "genetic entropy"...

I don't.

... you should be able to give me a formula that computes the genetic entropy of a given genome.

I can't, but here's a guess: ^S[sub]genome[/sub]>0

But here's a more fundamental question for you: what is the unit of genetic entropy?

I don't know, but here's a guess: heat.

 

[AV1611VET]

Dude, continually bringing Pluto up just displays your own ignorance.

I bring Pluto up for a simple reason:

• It's a very good example of how science "admits" it's been wrong all these years.

A thousand years from now, Atheists will be saying:

"Right! You Christians used to think Pluto was a planet until scientists proved you wrong!"

Just like we get the blame for teaching a "flat Earth".

I submit that what we saw happen with Pluto is the exact same thing that happened with this flat-Earth junk.

Scientists got together and determined that they were wrong about the Earth being flat all along, so in light of "new evidence to the contrary", the Earth became round; and then a thousand years later they blame it on Christians teaching it was flat.

 

[Chalnoth]

I bring Pluto up for a simple reason:

• It's a very good example of how science "admits" it's been wrong all these years.

No it's not. Science never defined what a planet was until now. And scientists haven't been telling us that Pluto was a planet. Many astronomers have been saying it's not a planet for some time now!

As far as I know, there was never a scientific consensus as to Pluto being a planet. Astronomers just didn't care that people called it such outside of astronomy circles.

There are much, much more valid examples that show how science is wrong. But this is an incredible strength of science, not a weakness.

A simple example is Newtonian mechanics. Newtonian mechanics is wrong. All physicists know it is wrong. And yet it is taught in every introductory physics class. More to the point, for some time, Newtonian mechanics had, unlike Pluto's status, been a scientific consensus.

So how did an incorrect theory reach scientific consensus? And why is this a good thing? The how is simple: Newtonian mechanics was shown to be correct across a wide variety of experimental situations. Physicists did many experiments for over a century that all coincided with Newton's laws.

This shows us today that Newton's laws are still an important part of the whole picture of physics: they are applicable to a wide variety of experiments. The scientific community would never have reached consensus about the accurateness of Newton's laws if this were not so. When our experiments started to probe the very large, the very fast, and the very small, we sarted to see problems.

And scientists, unlike modern-day creationists, were willing to accept that Newton's laws could be wrong. They looked at the experiments, and slowly came to understand that their basic understanding of the nature of the universe had to be modified. Newton's laws were still correct within their range of application, and thus are still taught. We are not lying to students, we are simply teaching them physics that is easier to understand and apply before they get to the hard stuff.

The same is true of every single widely-accepted scientific theory: each has been shown to be correct within a valid range of application. This is as true with the theory of evolution as with every other scientific theory that has reached consensus. It is always possible that the theory will have to be modified in areas where we have yet to measure (an example is the modern idea of punctuated equilibrium), but evolution has been shown to be valid across a very wide range of application, and its nature makes it very unlikely that evolution will be overhauled completely.

 

[Chalnoth]

I would teach that this invalidates Evolution - as the Earth has only been in existence 6000 years.

The evidence says otherwise.

The whole point of entropy is that there's coming a time when there will be no more Sun, because the universe is going to wind down to one uniform temperature.

Well, our sun will go red giant after ~5 billion years. But the universe won't experience heat death until another ~70 billion years or so.

In that amount of time, if we survive by moving off of this little blue ball, we might actually develop the technology to conserve what entropy is available to extend our ability to live much longer. But whichever way you slice it, heat death isn't a problem that we will ever have to deal with.

 

[WakeForest13]

Why does it matter if Pluto is called a planet or not? If it was up to modern scientists, I doubt any of the major planets would be so clearly distinguished from other orbiting objects in the solar system. The reliance on the term "planet" (which I believe is a derivative of the Greek word "wanderer") only exists because that's what people first called the things they could see in the sky that lit up, but weren't stars. As we discovered other "planets," they fell into the previous system.

It means absolutely nothing at all whether Pluto is classified as a planet or an ice monster, it still behaves exactly the same as astronomers have previously predicted.

 

[AV1611VET]

No it's not. Science never defined what a planet was until now. And scientists haven't been telling us that Pluto was a planet. Many astronomers have been saying it's not a planet for some time now!

As far as I know, there was never a scientific consensus as to Pluto being a planet. Astronomers just didn't care that people called it such outside of astronomy circles.

Right --- and I bet you have some land to sell me in Florida.

Where do you think I saw my first picture of Pluto?

That's right --- in a science book --- (or maybe it was the encyclopedia).

Scientists even haggled over there being a 10th planet.

In any even, you're adhering to the tenets of Science just as tenaciously as we do Christianity --- and time will tell who wins in the end - (not that they're against each other).

Your science doesn't like my Jesus walking on water, and my Bible doesn't like your evolution.

I suggest you learn to enjoy my little Plutonian example of scientific backpedaling - I plan to use it whenever apropos.

BTW, what happened to Charon?

 

[AV1611VET]

But whichever way you slice it, heat death isn't a problem that we will ever have to deal with.

I could say something here, but I'm not. You don't know how wrong that statement is --- and it's one of the main reasons I pray for people on this forum, sometimes by name, every day.

 

[Tomk80]

Basic creationists idea:
If scientists discover they are wrong, they change their ideas to accomodate the new viewpoint. Because science changes ideas and frameworks when they turn out to be wrong, science is wrong.

On the other hand, if creationism is discovered to be wrong, the ideas in creationism are not changed. Therefore, creationism is right.

 

[Chalnoth]

Right --- and I bet you have some land to sell me in Florida.

Where do you think I saw my first picture of Pluto?

That's right --- in a science book --- (or maybe it was the encyclopedia).

That doesn't mean anything. Scientists have no problem at all with bowing to cultural definitions for introductory science books for unimportant issues. We don't consider it to be a big problem that we aren't telling students the whole story: telling them the whole story would be entirely too complex and just serve to sow confusion. Whether or not Pluto is a planet is not considered important.

Scientists even haggled over there being a 10th planet.

More. And this is the primary strength of science: the debate. Science doesn't hold itself to be holy: any part of science is subject to reevaluation, modification, and, in some cases, replacement.

In any even, you're adhering to the tenets of Science just as tenaciously as we do Christianity --- and time will tell who wins in the end - (not that they're against each other).

As tenaciously, perhaps, but for a wholly different reason: evidence. You hold tenaciously to Christianity out of blind faith. I hold to the fact of evolutionary theory, as well as many other scientific theories, due to the overwhelming evidence.

BTW, what happened to Charon?

Nothing. It and Pluto are still orbiting one another. It's just that under one competing definition of a planet from the ratified one, Charon also had to be considered to be a planet.

 

[AV1611VET]

It means absolutely nothing at all whether Pluto is classified as a planet or an ice monster, it still behaves exactly the same as astronomers have previously predicted.

Okie-doke, tell that to the college students going to school next semester, who'll have to buy new science books.

Tell that now to our public schools, whose science books are all out-of-date.

And I can't help but to think, that just like eggs causing cancer, then not, then causing cancer again, then not, etc. --- in a couple years (if not sooner), Pluto will be put right back where it has been for the last 76 years.

 

[Chalnoth]

I could say something here, but I'm not. You don't know how wrong that statement is --- and it's one of the main reasons I pray for people on this forum, sometimes by name, every day.

You actually believe that it is possible for heat death to occur within our lifetime? As a student of cosmology, I can assure you that this is utterly and completely impossible. What is your evidence for this ridiculous statement?

 

[Chalnoth]

Okie-doke, tell that to the college students going to school next semester, who'll have to buy new science books.

No they won't, because it doesn't affect anything but a name. It doesn't change anything at all about the content of the text. Hell, I don't think any scientists at all will care if people outside of astronomy continue to call Pluto a planet. It doesn't change anything.

Anyway, yes, it is always possible that Pluto will regain its planet status in scientific circles, but this is still just a change in definition: it doesn't change anything at all about our understanding of the universe. I personally doubt it will happen. Pluto is a Kuiper Belt object, and is distinctly different from the 8 planets.