If you want kids to learn creation science, show how you'd teach it.

[AV1611VET]

What, in your mind, constitutes a "pure" gene as opposed to an impure one?

The closer to minimum entropy the purer the gene. Therefore the purest genes would be the ones possessed by Adam and Eve, and the animals created in Genesis 1.

Take the cheetah for instance. It has a build similar to a dog and feet like a dog. Yet many of the other body traits are more consistent with a cat. So is it a dog-kind, a cat-kind or a cheetah-kind and why?

My guess would be cat-kind. The worst example imaginable, from the seminar I attended, is the Duckbill Platypus.

 

[MrGoodBytes]

The closer to minimum entropy the purer the gene. Therefore the purest genes would be the ones possessed by Adam and Eve, and the animals created in Genesis 1.

What do you mean by "minimum entropy"?

 

[rmwilliamsll]

The closer to minimum entropy the purer the gene. Therefore the purest genes would be the ones possessed by Adam and Eve, and the animals created in Genesis 1.

one would suppose that the purer the genes means the more homozygous they are. the problem is that change, especially the rapid radiative change YECists propose after the flood to account for the multitude of various species derived from their 'kinds" requires an enormous number of variant alleles at most loci. Yet here we get a statement of the exact opposite-few variant alleles.

one of the problems with trying to combine Scripture and science is that you forget what you tried to prove a few minutes ago and contradict it in the very next paragraph.

o'well back to the YECists drawing board.

 

[AV1611VET]

What do you mean by "minimum entropy"?

In this case, the least amount of degeneration.

When God created the Universe, He pronounced it "very good".

[bible]Genesis 1:31[/bible]

Given the fact that He pronounced each separate day as "good" ---

[bible]Genesis 1:4[/bible][bible]Genesis 1:10[/bible][bible]Genesis 1:12[/bible][bible]Genesis 1:18[/bible][bible]Genesis 1:21[/bible][bible]Genesis 1:25[/bible]

--- then stepped back and pronounced His creation as "very good" ---

[bible]Genesis 1:31[/bible]

--- tells me that the whole was greater than the sum of its parts (IOW, "perfect").

This perfection is what we would call "minimum entropy" --- BUT --- that term DID NOT APPLY YET --- since the 2nd Law of Thermodynamics didn't even exist, yet.

It was introduced as a result of the Fall in Genesis 3 --- so we're talking "super-pure" genetics here.

 

[shernren]

Of all the creationist fallacies there are, 2LoT abuses get up my nerves the most. You want to know how information entropy works?

A message consisting of a complete repetition of symbols has minimum entropy.
A message consisting of a completely random sequence of symbols, with each symbol appearing an equal number of times, has maximum entropy.

And for that reason, any animal whose DNA had minimum entropy would never survive.

 

[Chalnoth]

This perfection is what we would call "minimum entropy" --- BUT --- that term DOES NOT APPLY YET --- since the 2nd Law of Thermodynamics didn't even exist, yet.

So I imagine you ascribe to the erroneous idea that because of the second law of thermodynamics, life cannot ever evolve into more complex forms?

This is blatantly false: the second law of thermodynamics applies to closed systems, as I have said to you in the past. In a closed system, the entropy can never decrease. But life forms are not closed systems. If you place any life form in an insulated box and shut it off from the world it will eventually die: life forms depend upon interactions with sources of entropy, such as the sun (which provides a source of entropy through the uneven heating of the Earth which results in a continual lowing of the entropy of the Earth).

 

[AV1611VET]

one would suppose that the purer the genes means the more homozygous they are.

I'm not an authority on Genetics, so I'll agree for the sake of the discussion.

...the problem is that change, especially the rapid radiative change YECists propose after the flood to account for the multitude of various species derived from their 'kinds" requires an enormous number of variant alleles at most loci.

Again, I'll agree on the grounds of ignorance. I'd like to point out though, that I'm not a YEC.

Yet here we get a statement of the exact opposite-few variant alleles.

I'll say 'yes' to that. Either they were "locked" pending the fall, or they were non-existent until after the Fall - I don't know. All I know is, what is here today is here today, and what was here yesterday was here yesterday.

I'm not going to deny my great-great-great-great grandniece's neighbor's best friend's second cousin's great-great-granddaughter existed, because I haven't seen the birth certificate.

one of the problems with trying to combine Scripture and science is that you forget what you tried to prove a few minutes ago and contradict it in the very next paragraph.

I highly doubt that --- I have no problem reconciling Scripture with Science --- as the two aren't mutually exclusive.

Jesus demonstrated a complete mastery over Science, and didn't need it to explain the things He did.

As a believer in Jesus --- I also believe His miracles.

o'well back to the YECists drawing board.

Not with me --- I don't go there.

 

[AV1611VET]

Of all the creationist fallacies there are, 2LoT abuses get up my nerves the most. You want to know how information entropy works?

Information Entropy is another discussion in itself.

Since information has no mass, it is not subject to genetic entropy.

Nor entropy of any kind, for that matter; unless you consider such things as "jamming" and "interference" to be types of entropy.

 

[Caphi]

Information Entropy is another discussion in itself.

Since information has no mass, it is not subject to genetic entropy.

Nor entropy of any kind, for that matter; unless you consider such things as "jamming" and "interference" to be types of entropy.

I suggest you read The Fifth Miracle by Paul Davies. It has an entire section on the relevance of the entropy concept to information transmission.

 

[AV1611VET]

So I imagine you ascribe to the erroneous idea that because of the second law of thermodynamics, life cannot ever evolve into more complex forms?

I never really stated that, per se; but I have given 4 axioms against Evolution, and my pet axiom is that evolution needs millions of years of operation to arrive at today's matrix.

This is blatantly false: the second law of thermodynamics applies to closed systems, as I have said to you in the past.

I'm familiar with that --- nevertheless --- matter is in a state of constant decay, and whenever a process is performed, energy is lost, leaving net energy, not gross energy.

Why do you think we can't build perpetual motion machines?

 

[AV1611VET]

I suggest you read The Fifth Miracle by Paul Davies. It has an entire section on the relevance of the entropy concept to information transmission.

Because to be honest, Creation is my forte, and it has nothing to do with Science, as this universe was not created by natural processes.

Scienctific results can be manipulated to create a "false echo", and we need something that is outside of the realm of Science to explain this Universe's matrix.

 

[Beastt]

Because to be honest, Creation is my forte, and it has nothing to do with Science, as this universe was not created by natural processes.

Scienctific results can be manipulated to create a "false echo", and we need something that is outside of the realm of Science to explain this Universe's matrix.

I just really have to ask; if you can't even see the obvious evidence within the supposed creation which clearly shows that it was a natural process, how do you come to the conclusion that creation is your forte'?

Your comment is not terribly dissimilar to; "electronics is my forte' and cathode ray tubes are not electronic devices."

 

[Beastt]

The closer to minimum entropy the purer the gene. Therefore the purest genes would be the ones possessed by Adam and Eve, and the animals created in Genesis 1.

So your claim is that genetic information is deteriorating?

My guess would be cat-kind. The worst example imaginable, from the seminar I attended, is the Duckbill Platypus.

"Guess?" You want to teach this stuff to children and you have to guess? I thought you knew what a "kind" was. If it were any form of clear classification guessing wouldn't be necessary. So you're suggesting children be taught a means of classifying animals where a guess is as good as it gets?

 

[Beastt]

In this case, the least amount of degeneration.

When God created the Universe, He pronounced it "very good".

[bible]Genesis 1:31[/bible]

Given the fact that He pronounced each separate day as "good" ---

[bible]Genesis 1:4[/bible][bible]Genesis 1:10[/bible][bible]Genesis 1:12[/bible][bible]Genesis 1:18[/bible][bible]Genesis 1:21[/bible][bible]Genesis 1:25[/bible]

--- then stepped back and pronounced His creation as "very good" ---

[bible]Genesis 1:31[/bible]

--- tells me that the whole was greater than the sum of its parts (IOW, "perfect").

This perfection is what we would call "minimum entropy" --- BUT --- that term DID NOT APPLY YET --- since the 2nd Law of Thermodynamics didn't even exist, yet.

It was introduced as a result of the Fall in Genesis 3 --- so we're talking "super-pure" genetics here.

"Very Good" is a pretty poor standard for a perfect entity, is it not?

And how do you know the degree of entropy for any gene? How do you recognize a gene of greater or lesser entropy? What would we be looking for? How do they differ? Try being specific.

 

[AV1611VET]

I just really have to ask; if you can't even see the obvious evidence within the supposed creation which clearly shows that it was a natural process, how do you come to the conclusion that creation is your forte'?

Your comment is not terribly dissimilar to; "electronics is my forte' and cathode ray tubes are not electronic devices."

After becoming a Christian, I don't want to return to using the Periodic Table to explain God's universe.

[bible]Galatians 4:9[/bible]

Science without God is bondage:

[bible]Galatians 4:3[/bible]

 

[AV1611VET]

So your claim is that genetic information is deteriorating?

I thought I already explained that. Information has no mass.

In fact, evolutionists cannot explain where the massive amounts of information needed to evolve upward comes from.

"Guess?" You want to teach this stuff to children and you have to guess? I thought you knew what a "kind" was.

I thought I defined it to your satisfaction; but then you wanted examples, and I gave you one.

Then you rejected my example as too simplistic, so, as far as I'm concerned, go ahead and think I'm ignorant of the subject.

If it were any form of clear classification guessing wouldn't be necessary. So you're suggesting children be taught a means of classifying animals where a guess is as good as it gets?

Well evidently even Pluto's classification isn't as clear as they thought it was; since it had to be voted on after 76 years - in light of "new information acquired".

 

[AV1611VET]

"Very Good" is a pretty poor standard for a perfect entity, is it not?

I showed you how to correctly interpret the information given. Yes, 'very good' is substandard to a perfect entity - unless He operates on a higher vocabulary than we do.

And how do you know the degree of entropy for any gene?

I'm not interested in its current state of decay; its output is sufficient enough.

How do you recognize a gene of greater or lesser entropy?

By what it produced.

What would we be looking for?

The result of its output (viz. coyote, dog, wolf, or dingo) determines it level of decay.

How do they differ?

By amount of information encoded, and how much that information is "jammed" or "interfered" with.

Try being specific.

LOL

 

[Beastt]

After becoming a Christian, I don't want to return to using the Periodic Table to explain God's universe.

So then your beliefs have nothing to do with what is or isn't; it's just all about what you want to believe or want to disbelieve?

Science without God is bondage:

Science without God is reality.
Continued adherance to that which cannot be demonstrated is bondage.

 

[Beastt]

I thought I already explained that. Information has no mass.

Information itself has no mass. But that information must be stored in a physical form. That physical form does have mass. Why do you think hard drive storage has a physical limit?

In fact, evolutionists cannot explain where the massive amounts of information needed to evolve upward comes from.

That's because you first have to demonstrate the addition of information. Tell me which of these lines contains the most information.

CAACCCCGATACATCGATACATACCCCGCACCCCCAAGAACGGACGAC ->
CTATAGAAATACATCGATGAATGAAGAACTAACGTTCTATCTCACTAT

or​

ATAAATACATAAATAAATAAATAAATAAATACATAAATACATAAATAC ->
ATAAATACATACATAAATAAATAAATACATACATAAATAAATAAATAC

I thought I defined it to your satisfaction; but then you wanted examples, and I gave you one.

You gave me what you presented as a guess. I wanted clearly defined properties just like biology must use in order to classify animals. If you have no definitive system, then the word "kind" is pretty much meaningless.

Then you rejected my example as too simplistic, so, as far as I'm concerned, go ahead and think I'm ignorant of the subject.

I can only base my impression upon what you can or can't provide. If you think an accurate classification system can rely upon whims and guesses, then I have little choice but to determine that you are woefully short of holding a working understanding of the subject you seem to feel qualified to teach to children.

Well evidently even Pluto's classification isn't as clear as they thought it was; since it had to be voted on after 76 years - in light of "new information acquired".

What new information do you feel is present in the classification of "kinds"? How can genetics be deteriorating, and at the same time be gaining new information?

 

[Chalnoth]

I never really stated that, per se; but I have given 4 axioms against Evolution, and my pet axiom is that evolution needs millions of years of operation to arrive at today's matrix.

Billions. So what?

I'm familiar with that --- nevertheless --- matter is in a state of constant decay, and whenever a process is performed, energy is lost, leaving net energy, not gross energy.

Why do you think we can't build perpetual motion machines?

Why do you think we can build solar power generators? They do nothing but sit in place, and yet we can get energy from them. This is the basis of most life on the planet (thermal vents and things support some small amount of life).