• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

For those wondering what "macroevolution" actually is...

Status
Not open for further replies.

tas8831

Well-Known Member
May 5, 2017
5,611
3,999
56
Northeast
✟101,040.00
Country
United States
Gender
Male
Faith
Atheist
Marital Status
Married
Yup. That's an actual gene sequence for an actual thing. (I should've written down what it was, though.) And I did change something in it.
My gosh - HOW TO TELL????

Reminds me of one of my old antics in replying to the folks claiming to be totally knowledgeable about genetics and to be able to measure "information" - I would post the sequence for an entire gene and ask them to tell me how much information there is in it, and what it does. Without fail, if they replied at all, it would be to ask me what the sequence was...
 
Upvote 0

tas8831

Well-Known Member
May 5, 2017
5,611
3,999
56
Northeast
✟101,040.00
Country
United States
Gender
Male
Faith
Atheist
Marital Status
Married
It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

This might be of interest to you wrt your analogies and definitions:

As someone who writes code to study genetics for a living (my job title is 'senior computational scientist')... yeah. To the extent that genetics does resemble software, it resembles software that wasn't designed, that is riddled with redundancies, unused, dead code, patches to repair earlier bugs, and multiple modules doing similar things that look like they were written by different people.​
 
  • Informative
Reactions: Astrophile
Upvote 0

Subduction Zone

Regular Member
Dec 17, 2012
32,629
12,069
✟230,471.00
Faith
Atheist
Marital Status
Single
You tell me, how can you tell which piece of information I corrupted?
CAGGAGTAGAGTGACCCAACAGGAGCCATTGGAGGCAGGA
TTTGTAGTAAAAAGAGGGTTAAGTTCTCCCTGGTTCCTGA
GGTAGGTTGTGATAGGCTTGTTTGAATAATTTTGTGGAGT

I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?
 
Upvote 0

Bradskii

Old age should burn and rave at close of day;
Aug 19, 2018
24,043
16,488
72
Bondi
✟390,008.00
Country
Australia
Gender
Male
Faith
Atheist
Marital Status
Married
I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?

Isn't it so weird when you only get the one result.

Hmm. Tried changing one letter and pasted the sequence into this post (now obviously edited out), saved changes and did a Google search - and it couldn't find it.
 
Last edited:
Upvote 0

Subduction Zone

Regular Member
Dec 17, 2012
32,629
12,069
✟230,471.00
Faith
Atheist
Marital Status
Single
Isn't it so weird when you only get the one result.

Hmm. Tried changing one letter and pasted the sequence into this post (now obviously edited out), saved changes and did a Google search - and it couldn't find it.
He created his own unique internet baby:D
 
Upvote 0

FrumiousBandersnatch

Well-Known Member
Mar 20, 2009
15,405
8,144
✟356,992.00
Faith
Atheist
To clarify:

At some point between a single celled (bacteria like) organism and a human being- some evolution must take place.

Darwinism claims that this can occur through random corruption of the genetic information within that less evolved life form.

At least that is the modern synthesis of the Victorian age theory.

What we actually observe scientifically, empirically though, is that mutations are overwhelmingly destructive- they lead to decline over time, fish losing sight, birds losing flight, bacteria losing the ability to digest certain compounds etc etc.

This concurs with the fossil record wherein new biological form generally appears suddenly and in complete form, then remains in stasis and/or decline until extinction- or it is still here.
This is false. Beneficial mutations can occur in non-functional parts of the genome, or restore function that was lost. The result may be advantageous loss of redundant or obsolete function, or advantageous gain of lost or new function. There is also a selection effect for naive observers, in that vestigiality is often more obvious than exaptation or the slow evolution of novel traits
 
Upvote 0

Tinker Grey

Wanderer
Site Supporter
Feb 6, 2002
11,747
6,302
Erewhon
Visit site
✟1,145,756.00
Faith
Atheist
I won't be letting the cat out of the bad by telling that that Google searching this did not good at all. Google found one result. Would you care to guess what it was?
Well when I get back to work on Monday, I can check my search history and let you know.

....OOOOOH (the penny drops). Google found this.
Prolly cuz of the change
 
Upvote 0

Subduction Zone

Regular Member
Dec 17, 2012
32,629
12,069
✟230,471.00
Faith
Atheist
Marital Status
Single
Well when I get back to work on Monday, I can check my search history and let you know.

....OOOOOH (the penny drops). Google found this.
Prolly cuz of the change
Exactly! If you had not made a change it could have been found at quite a few sites. Your version appears to be unique, and that is rather hard to accomplish today.
 
Upvote 0

Tinker Grey

Wanderer
Site Supporter
Feb 6, 2002
11,747
6,302
Erewhon
Visit site
✟1,145,756.00
Faith
Atheist
Exactly! If you had not made a change it could have been found at quite a few sites. Your version appears to be unique, and that is rather hard to accomplish today.
I am not exactly sure that's it. I tried searching just a section of that I was pretty sure I hadn't changed and it still found only this website. I suspect that the portion I snipped wasn't "indexable" by Google? Well, I'll check my history Monday and we'll see.
 
Upvote 0

Bradskii

Old age should burn and rave at close of day;
Aug 19, 2018
24,043
16,488
72
Bondi
✟390,008.00
Country
Australia
Gender
Male
Faith
Atheist
Marital Status
Married
Exactly! If you had not made a change it could have been found at quite a few sites. Your version appears to be unique, and that is rather hard to accomplish today.

'A Googlewhack is a contest to find a Google Search query that returns a single result. A Googlewhack must consist of two words found in a dictionary, and is only considered legitimate if both of the search terms appear in the result.' Wiki
 
Upvote 0

FrumiousBandersnatch

Well-Known Member
Mar 20, 2009
15,405
8,144
✟356,992.00
Faith
Atheist
I am not exactly sure that's it. I tried searching just a section of that I was pretty sure I hadn't changed and it still found only this website. I suspect that the portion I snipped wasn't "indexable" by Google? Well, I'll check my history Monday and we'll see.
Try searching the Library of Babel for it ;)
 
Upvote 0

Tinker Grey

Wanderer
Site Supporter
Feb 6, 2002
11,747
6,302
Erewhon
Visit site
✟1,145,756.00
Faith
Atheist
Upvote 0

tas8831

Well-Known Member
May 5, 2017
5,611
3,999
56
Northeast
✟101,040.00
Country
United States
Gender
Male
Faith
Atheist
Marital Status
Married
I believe that's a commonly misspelled town in the province of Nunavut.
Ah - the old "I'll make a stupid joke when my bluff is called on something that I present myself as having superior knowledge on"...

Typical creationist.
 
Upvote 0

tas8831

Well-Known Member
May 5, 2017
5,611
3,999
56
Northeast
✟101,040.00
Country
United States
Gender
Male
Faith
Atheist
Marital Status
Married
Yup. That's an actual gene sequence for an actual thing. (I should've written down what it was, though.) And I did change something in it.
As I've suspected all along - he's just another bloviating YEC hoping to bluff his way through an "argument" with people better informed on the subject.
 
Upvote 0

tas8831

Well-Known Member
May 5, 2017
5,611
3,999
56
Northeast
✟101,040.00
Country
United States
Gender
Male
Faith
Atheist
Marital Status
Married
It's literally a copying error.. in digital information... data that has developed an error can be accurately described as corrupted.

If only genomes/genetics really did function EXACTLY like you computer software... You can't - or won't - even consider that the possibility that your repetitious regurgitation of an argument via false analogy might not be the winner your proudly believe it to be.

Never taken a biology class, much less a genetics class, have you?

The Phil Johnson effect...
 
Upvote 0

Buzzard3

Well-Known Member
Jan 31, 2022
1,526
229
65
Forster
✟60,101.00
Country
Australia
Gender
Male
Faith
Catholic
Marital Status
Single
Politics
AU-Liberals
Macroevolution is NOT 'an event' that needs to be 're-created.' It is an observed pattern.
Macroevolution is not an "observed" anything - it has never been observed and is nothing more than an assumption.

Furthermore, thousands of years of humans experimenting with microevolution - in the form of animal and plant breeding - strongly suggest that macroevolution is a scientific impossibility.
 
Upvote 0

AV1611VET

SCIENCE CAN TAKE A HIKE
Site Supporter
Jun 18, 2006
3,856,319
52,684
Guam
✟5,166,640.00
Country
United States
Gender
Male
Faith
Baptist
Marital Status
Married
Politics
US-Republican
Macroevolution is not an "observed" anything - it has never been observed and is nothing more than an assumption.
Macroevolution is nothing more than a game of connect-the-dots that only looks good on paper.
 
Upvote 0

Buzzard3

Well-Known Member
Jan 31, 2022
1,526
229
65
Forster
✟60,101.00
Country
Australia
Gender
Male
Faith
Catholic
Marital Status
Single
Politics
AU-Liberals
Macroevolution is nothing more than a game of connect-the-dots that only looks good on paper.
Well said. It's more wishful thinking than science.

Consider dog breeders, for example, who have over thousands of years tried every trick imaginable in their attempts to produce novel breeds, but they've discovered that exploiting genetic variations has limits ... push the envelope too far and the result is sickly, weak, unfit dogs - that is devolution, the opposite of evolution!
In the light of such genetic limitations, macroevolution (by natural means) appears to be nothing more than a unscientific fantasy.
 
  • Agree
Reactions: AV1611VET
Upvote 0
Status
Not open for further replies.