NASAg03 said:
Based on that translation. Some have interpreted this to be "chaos and order", since these verses state "evening" then "morning" in reference to day, rather than the typical "morning and evening" format.
Of course such translations have occurred. Name any verse in the Bible which can be demonstrated to be wrong in what it actually says and you can find a number of different interpretations that state other than what the Bible says. But as much as such interpretations do allow people to continue belief in a failed statement, it doesn't change the text of the Bible. Genesis is talking about creation and it does so on a timeline of days. It continually steps us through day by day. But when we run into problems like the way the geological timeline differs so sharply from that in the Bible, then suddenly "day" doesn't mean day, "morning" doesn't mean morning and "evening" doesn't mean evening. I've even had people try to tell me that the "light" in verse 3 actually means goodness because there is no real reason to believe the Earth existed before the more fundamental components in the universe, (like light). Then you show someone that the Bible has plants growing in Genesis 1:11 but no sun for light until Genesis 1:14 and they jump to Genesis 1:3 and proclaim that there was light. Suddenly "light" means light again.
All of this interpretation which goes on constantly does nothing but provide the believer with a way of continuing to believe that which doesn't make sense. It's a common practice. If something in the Bible can be shown to be wrong or contradictory, just find a few words, claim they mean something, (often anything), other than the words used and go happily about the belief.
Would I be given the same latitude as a Christian if I were to go about making changes to the Biblical text? If I proclaim, "Only fighter jets travel faster than light", would you believe my statement to be incorrect or would you be compelled to believe I was right if I told you that by "light", I meant the kind-hearted gesture of a good samaritan?
Why is it so easy for Christians to believe that God's word is in such constant need of their help to salvage it from the demonstrated fallability of its own claims? Talk about the Bible with those who show a psychological need to believe it as God's word and you're told that "evil" means "disaster", "void" means chaos, "light" means goodness, "global" means local, "Hell" means separation from God, "fear" means respect, "day" means time-unit, and the Genesis chronology means nothing at all. I once started a thread to track some of these claimed translative contortions. It didn't last two days because it exposed the tactic use to try to bring credibility to the Bible.
NASAg03 said:
The unit of measure for the 6 groups of events was a day, or 86400 seconds. Depending on the location in the universe, and the rate of expansion of the universe, those 86400 seconds could be slower as a result of relativity, allowing for many events in our galaxity to occure in those 86400 seconds.
A day can be defined as the amount of time required for the Earth to complete one rotation on its axis. The number of seconds really doesn't matter because no one in biblical times had a time-piece capable of accuracy down to a second. The fact of the matter is, the book uses the word "day" and then defines a day as being "morning" to "evening". It walks through a chronology, including specific events for each day. It talks about the lights in the firmament (sun and moon), which can be used to divide the "day" from the night. But this creates a problem for those who wish to believe in the Bible as the word of God because we know the changes in Earth's topography claimed in Genesis 1:9 didn't occur in a day, (as well as many other demonstrably incorrect statements). So believers try to find a way for the book to still be correct. And the only way they can do this is to constantly change what it says. But they can't even remain consistent within their own edits. "Day" doesn't mean a day when we look at the six day creation, but it does mean a day when the sun and moon separate "day" from night.
Genesis 1:3 talks about light, but it can't be light from the sun because there is no sun until Genesis 1:14. So believers decide "light" must mean something else. Some suggest it means "goodness", despite the fact that there isn't any life on the Earth yet so there can't be any good or bad yet. Then we move right into Genesis 1:5 where it talks about God calling the "light", "day" and the darkness "night". Well, we know that what we call "day" is when the sun is lighting our part of the planet and when we're in an area of the planet not lit with sunlight, we call it "night". It all makes sense if you maintain the context and retain the words used. But it's wrong. It's easily shown to be completely lacking in credibility. So the words and the context are tossed into the garbage in order to try to salvage each verse separately.
NASAg03 said:
right, because evolution is a continnual process, meaning it can slow down.
Meaning it can speed up, pause and slow down but mostly, it means that evolution doesn't have a goal. The only goal is continued survival. Speaking from an evolutionary standpoint, humans are no more a goal or intended destination than are amoeba, ferns or mushrooms.
NASAg03 said:
so what are you saying here? we are in fact more complex than other "lower life forms", with the ability to think and reason. who's to say there isn't something beyond thinking that differentiates us from animals.
You're using non-sensical terms like "complex" and "lower life forms". We're not more complex than the other animals. Many "lower life forms", such as frogs are genetically encoded for more than one physical configuration. We're born with a head, two arms and two legs. Frogs are born with a body and a tail. Later they develop legs and absorb the tail. All of that is in their genetic encoding which makes their genetic encoding more "complex" than ours.
"It is just like man’s vanity and impertinence to call an animal dumb because it is dumb to his dull perception." -- Mark Twain
Mr. Clemons nailed that one right on the head. What man has done is to develop a rating system based on his own assumption that he must always be the measure of superiority. Where do we excel? We're more intelligent than the other animals. So certainly intelligence must be the mark of superiority. But think for a moment if you were a bird and looking to the other animals. Surely you must be superior to them, (save the bat and insects), because you are not bound to the ground as are the other animals. But to the giant squid, few animals can compare to them because they can exist in ocean depths so extreme that most other animals would be crushed by the pressure of the water. Humans could never even start to approach those depths and still can't even inside a billion dollar submarine. Compared to them, we're frail and incapable of withstanding even moderate changes in pressure. To the cheetah we're unbearably slow. To a snake our natural method of mobility is crude and clumsy. We're not able to slither forth at a constant pace. Instead we tip ourselves off balance, then catch ourselves as we start to fall, then tip ourselves off balance again. Certainly we are demonstrably inferior to a snake. To a dolphin, we might be somewhat more intelligent, but that, of course, depends upon measures of intelligence devised by humans. But when it comes to hearing, we're practically deaf. Our sense of smell ranks us well below most other animals and our ability to triangulate sounds leaves us marvelling at the the ability of an owl.
So we look for the one area where we do excel, post that as the mark of superiority, and then proclaim ourselves to be the supreme measure of superiority among the animals. And you seem to think that implies some increased level of complexity. But it doesn't. It requires only a very tiny variation to our genetic code as compared to other primates. Overall our genetic code differs from that of a chimpanzee by about 2%. Note that doesn't mean we're 2% more "complex", we're just 2% different. The other 98% of our genetic encoding is exactly like that of a chimpanzee. But you look to intelligence as the measure and the capacity for intelligence seems to lie in the number of neurons in the brain. So how can we be so like the chimpanzee and yet be so much more intelligent, (again, using our own tests as a determinant)? So lets step down a bit in our comparison. Instead of comparing a human to a chimp, let's compare ourselves to a sea slug. The average human has about 100 million times the number of neurons found in the brain of a sea slug. Certainly we must have a vastly more complex genetic coding, right? Wrong.
At some point in the development of animals, there must be a single first cell committed to generating neurons. That cell divides resulting in two neurons. Division of those results in four, then eight. After about a dozen divisions, you have enough neurons to run a sea slug. So what does it take to reach the number of neurons in the human brain? It takes about another 25 rounds of cell division. Drop off about two rounds of division and you have a chimpanzee. So the difference in genetic encoding might be expressed as...
Sea Slug = (First Neuron * 2^12)
Human = (First Neuron * 2^37)
(Source: Discover Magazine, April '06)
Let's break that down into binary based on ASCII equivalents so we might better understand the difference in "complexity". We'll use "N" for the first neuron. Keep in mind that this would represent only a very tiny snippet of the entire genetic code; only that part which determines the number of divisions for neuron production.
Sea Slug = 010011100010101000110010010111100011000100110010
Human ...= 010011100010101000110010010111100011001100110111
Can you find that vast difference in complexity? Perhaps you prefer the ACGT code of DNA? No problem. Just equate 00 to "A", 01 to "C", 10 to "G" and 11 to "T" and it looks like this.
Sea Slug = CATGAGGGATAGCCTGATACATAG
Human ...= CATGAGGGATAGCCTGATATATCT
(That's based on 8-bit ASCII equivalents. Using numeric coding the difference is 001100 vs 100101 or "ATA" vs "GCC".)
Which one is more complex?
We have more neurons. Some animals have a better sense of smell, others have better sight, hearing, mobility or tolerance for exposure to extremes. We're as different from them as they are from each other.
As for the ability to reason, there are a number of research programs which have conclusively demonstrated that animals can reason. Two prime examples are the Gorilla Foundation which has taught a number of Gorillas to communicate via a modified version of American Sign Language and the research work of Dr. Irene Pepperburg at the University of Arizona. She has two African Grey Parrots. The older of the two, "Alex", has an extensive vocabulary and utilizes it in context, to ask for what he wants, count objects, proclaim colors or pick out an object of particular color from a number of varying objects. He can count, express his desires and even create new phrases from the words he's learned such as "rock corn" to distinguish dried corn from fresh, frozen or that from a can. The old assumption that animals can't reason was defeated a long, long time ago. But religious conviction has kept the information from becoming as widely known as it should be.
NASAg03 said:
maybe science hasn't found this characteristic yet. in the mean time i will believe that difference to be a soul.
Do you know how we got that soul? I can't say for men, since religion, being an invention brought about mostly by the male of our species were always assumed to have one. But animals and women were a different story. So it eventually came down to a vote. Women squeaked by as the men, who were the only ones allowed to vote, decided that women probably had a soul. It was decided that animals didn't because too few men voted that they did.
NASAg03 said:
if you think we are no different than animals, then let me be the first to say, you're speaking for yourself, and at the very least, not me. maybe i should read more into your screen name.
An interesting guess concerning my screen name but completely removed from the truth concerning its origin. As far as your conclusion that you're different than the other animals, you're welcome to believe that since it seems to please you. But take note of the fact that you're unable to demonstrate this difference by any credible means. Indeed, humans are different from other species, but that's what divides species to begin with. Every species has differences from every other species, or they'd be the same species. We're of the species homo sapien. We are only as different from chimpanzees as chimps are from mountain gorillas. In fact, there are those scientist who argue that chimpanzees are more closely related to humans than to the other primates.
In the real world, we must base our evaluations upon the demonstrable. You're basing yours upon your imagination. We can show the differences between humans and other non-human animals and can show them to be no more significant than between one species of non-human animal and another. Biologically, we are monogastric herbivores, classifies as mammals, based on the same system used for all animal life; primates, based on the same classifications used for all animals; and apes, because we fit the classification for ape.
NASAg03 said:
Obviously not. Eve was human. But before creating Eve, God walked Adam about the other animal species looking for a mate... according to the Bible.
(cont.)
