-
Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.
-
CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.
The Truth about ERVs
- Thread starter Aman777
- Start date
1. Why would Adam have ERVs which you can't find? His blood did NOT have any ERVs. Adam didn't inherit the DNA nor the ERVs of ANY other creature since he was FIRST made. Gen 2:4-7 Your finding confirms God's Holy Word. You can't find the ERVs of ancient animals in Human blood until AFTER Noah arrived.
That's the reason your researchers can't find it. Humans inherited the DNA and ERVs of the common ancestor of Apes when Noah's grandsons married and produced children with the descendants of the sons of God (prehistoric people) who were on this Earth for Millions of years BEFORE Noah arrived in total agreement with Gen 6 1-4.
NIH:>>>Although there is NO EVIDENCE (as I posted) for it being ongoing in humans, retroviral integration is not something that only occurred in the distant past. In Australia we are currently witnessing a fulminant endogenization process in koala bears involving a retrovirus presumed to have been acquired from a species of Asian mouse only a hundred or so years ago (27–29).
2. It wasn't me saying there was NO EVIDENCE, but instead; was the National Institute of Health. It's Scientific verification of what I have been telling you, which is WHY I added the (as I posted). Your Claim that data shows that ERVs are ongoing in Humans, when the NIH tells us that there is NO evidence of such happening since 2 Million years ago, means that your view is soundly refuted.
God's Holy Word--- 1
ERV believers------- 0 Amen?
Upvote
0
Adam would have pre-integration sites which we could find. For example . . .
AGTCTTAGA---ERV---GTATCTAATCA human carrying an ERV
AGTCTTAGAGTATCTAATCA Adam not carrying an ERV
The underlined portion would be where the ERV insertion occurs in the humans carrying ERV's. We can find the pre-integration site in Adam's genome by comparing the flanking DNA around the ERV. We would be able to tell that there is not an ERV where there is supposed to be an ERV.
Which would mean that we would have pre-integration sites throughout our genomes as well as the ERV alleles to match them. This would be true for a large chunk of our ERV's, but that is not what we see. Therefore, your claims are false.
Vertical transmission of ERV's is ongoing. That is what you are ignoring.
Upvote
0
False. It's not me but the NIH which says Humans are Museums for ERVs happening 2 Million years ago. Noah didn't arrive until 10k years ago. Scripture agrees and shows that the sons of God (prehistoric people) passed on their ancestors ERVs to Humans, who first came to this Earth in the Ark. Human civilization can be traced to their arrival. Evols have NO evidence of How or When prehistoric people evolved into Humans. Do you? God Bless you
Upvote
0
First, you haven't shown a single verse talking about endogenous retroviruses.
Second, Adam's descendants would also have pre-integration sites that would be passed on. You keep ignoring that.
Upvote
0
1. Genesis 6:4 clearly tells us that the sons of God (prehistoric people) and Adam's daughters could produce children together. That is HOW the ERVs of the common ancestor of Apes entered into Humans. (descendants of Adam) It's the ONLY way to get them inside Humans just the same as it's the ONLY way to inherit the superior intelligence of Adam, who is destined to have dominion over every creature after Jesus returns. Gen 1:28
2. Adam's descendants lived in an entirely separate world that lasted only some 1620 years AFTER Adam sinned. Today's Science is totally ignorant IF there were any diseases on Adam's Earth since the people lived for 900 plus years or 10 times the age of people who inherited the ERVs of the prehistoric people who were here when Noah arrived.
Noah's grandsons came into a world of people who had Millions of years of ERVs piled up inside them, which they passed onto their Offspring. What you don't seem to understand is that today's Humans are the Offspring. Amen?
Upvote
0
Where does the Bible say that is how ERV's entered into the human genome?
Adam had pre-integration sites which are just as easy to detect as ERV's. So why don't we find any pre-integration sites for human ERV's that are fixed and conserved in all other primates?
Upvote
0
1. Gen 6:1-4 shows that the sons of God (prehistoric people) and Humans (descendants of Adam) and the resulting offspring will inherit the superior intelligence of Adam, who was made with an intelligence like God's. Gen 3:22 Here is the account with my (view) :
Genesis 6King James Version (KJV)
6 And it came to pass, when men (Adam) began to multiply on the face of the earth, and daughters were born unto them, 2 That the sons of God (prehistoric men) saw the daughters of men (Adam) that they were fair; and they took them wives of all which they chose.3 And the Lord said, My spirit shall not always strive with man, (Adam) for that he also is flesh: yet his days shall be an hundred and twenty years.
4 There were (intellectual) giants in the earth in those days; and also after that, when the sons of God (prehistoric men) came in unto the daughters of men, (Adam) and they bare children to them, the same became mighty men which were of old, men of renown.
Some falsely believe that the sons of God are fallen Angels but that is Scripturally False. Notice that Adam was flesh and so were the sons of God (prehistoric people) who evolved from the water exactly as God told us in Gen 1:21. We know they were flesh because they looked like and had the same bones as Humans. They left their skeletons all over the Earth.
2. Because your study is limited to the sons of God (prehistoric people) and does NOT apply to Humans (descendants of Adam) since Noah arrived only 10k years ago. Amen?
Upvote
0
Where does it mention retroviruses in the genome? Please cite that specific language.
We are using the genomes of modern humans. How does it not apply?
Upvote
0
God wrote the description of when and how it happened in Gen 6:4...BUT...
it cannot be understood except by those who have been born again Spiritually. Have you? If not, then you can understand that God knew unbelievers would be unable to comprehend thousands of years ago. Here is what He tells us:
1Co 2:14 But the natural man receiveth not the things of the Spirit of God: for they are foolishness unto him: neither can he know them, because they are spiritually discerned.
2. Correction: You are using the ERVs of the sons of God (prehistoric people) and NOT modern Humans (descendants of Adam) who arrived on this Planet only 10k years ago. In fact, you don't even acknowledge that Humans arrived then. Do you? Here is the empirical historic evidence of the arrival of the first Human farmers on this Planet.
http://www.fsmitha.com/h1/map00-fc.html
If you don't believe me then tell us HOW evolution suddenly changed animals into Human farmers during the last Ice Age? Does sitting on a block of Ice in a Cave magically change prehistoric people into Humans? Amen?
Upvote
0
Men wrote Genesis.
Prove it.
1. That is a God of the Gaps argument.
2. There was nothing sudden about it, and humans are still animals.
Upvote
0
1. False since no man of the time could have known we live in a Multiverse composed of at least 3 Heavens/Universes. Gen 1:6-8 and Gen 2:4 No man could have known that our Cosmos was made on the 3rd Day Gen 2:4 and the first Stars didn't light until the 4th Day, Gen 1:16 which was many Hundreds of Millions of years AFTER the Big Bang as Space Telescopes have just recently discovered. No ancient man could have known that "every living creature that moveth" was created and brought forth from the Water. Gen 1:21 Science agrees because the cells within our bodies cannot live without liquid water. No ancient man knew How and When the sons of God (prehistoric people) inherited the superior intelligence of Adam which is like God's intelligence. Gen 3:22 This also explains HOW the DNA and ERVs of the sons of God (prehistoric people) got inside today's Humans.
Notice that all these things are shown in the first chapters of Genesis. Can you explain HOW ancient men of 3k years ago knew and correctly wrote these scientific and historic Facts? Of course not since God, the Holy Spirit, is the Author of God's Holy Word.
2. You are a good example since you find it so hard to believe God's Truth. Amen?
3. Not so. The God of the Gaps argument is UnScriptural and vainly tries to show that there is a great Gap of time between Gen 1:1 and Gen 1:2
4. Tell us HOW Humans (descendants of Adam) can have possibly descended from the common ancestor of Apes since Adam was made Billions of years BEFORE any other Living Creature. Gen 2:4-7 Amen?
Upvote
0
That is something else you have invented from whole cloth.
It appears to be Ben West's Truth, since I don't see God posting in this thread. When you get done pretending to be God, perhaps you could start dealing with the facts.
Where is the scientific evidence for Adam being made billions of years ago? Where are the pre-integration sites that should be in human genomes if we are descendants of Adam?
Upvote
0
1. False. Here are the verses which confirm that God made at least 3 firmaments/Heavens by the 3rd Day. The following verse speaks of the firmament/Heaven which was made the 2nd Day.
Gen 1:8 And God called the firmament Heaven. And the evening and the morning were the second day.
Gen 2:4 ¶ These are the generations of the heavens (Plural) and of the earth when they were created, in the day that the LORD God made the earth and the heavens,
Add at least two HeavenS to the first one which was made the 2nd Day, to the THIRD Day, the SAME Day the Earth was made, Gen 1:9-10 and that makes Three Heavens within our Multiverse. God speaks of the THIRD Heaven in ll Corinthians 12:2.
2. I post God's Holy Word and my views are His. Haven't you noticed?
3. Adam was formed of the dust of the ground on the SAME Day as the Big Bang of the present Universe. Gen 2:4-7 He lived until the present 6th Day of Creation. Gen 5:5 Each of God's Days/Ages is several Billions of years in length, in man's time. A good example is the fact that it was some 3.77 Billion years ago when life first appeared in the water on our Earth. God shows that it was yesterday, on the 5th Day, when He commanded that life be created and brought forth from the Water. Gen 1:21
4. I have Faith that today's scientists, as we near the end, will continue to make discoveries which CONFIRM what is written in Genesis Chapter One. It shouldn't be long until the Rapture and then Armageddon. After all, all those events are certain to take place later on the present 6th Day/Age. Amen?
Upvote
0
Notice that they say firmaments/heavens, not multiverses as described by modern theories. Not the same thing.
They are both the words of men.
Nowhere does it say that in the Bible.
I just showed you the science that disconfirms your claims. We should find pre-integration sites throughout the human genome. They aren't there.
Upvote
0
↑
1. False. Here are the verses which confirm that God made at least 3 firmaments/Heavens by the 3rd Day.
Notice that they say firmaments/heavens, not multiverses as described by modern theories. Not the same thing.
I know of no one who teaches multiverses (plural). What God shows is that He made at least 3 Universes/firmaments/Heavens within His Multiverse by the 3rd Day, the SAME Day as the Big Bang of our Cosmos. Gen 2:4
2. I post God's Holy Word and my views are His. Haven't you noticed?
They are both the words of men.
False, unless you can show us HOW ancient men, who lived thousands of years before Science, correctly wrote the scientific and historic Truth we find in Genesis Chapter One, which is the entire HISTORY of God's Creation including Future events at the end of the present 6th Day. Gen 1:30
3. Adam was formed of the dust of the ground on the SAME Day as the Big Bang of the present Universe.
Nowhere does it say that in the Bible.
Here it is:
4 These are the generations of the heavens and of the earth when they were created, in the day that the Lord God made the earth and the heavens,
Adam's Earth was made the 3rd Day. Gen 1:9-10 This verse is telling us of other HeavenS (Plural) which were made the 3rd Day. The first Heaven was made the 2nd Day. Gen 1:8 The present Cosmos was made on the 3rd Day, the SAME Day Adam's Earth was made. On this 3rd Day:
5 And every plant of the field before it was in the earth, and every herb of the field before it grew: for the Lord God had not caused it to rain upon the earth, and there was not a man to till the ground. 6 But there went up a mist from the earth, and watered the whole face of the ground.
The plants and trees GREW on the 3rd Day. Gen 1:12 These verses are speaking of the THIRD Day AFTER the Earth was made but BEFORE there were any plants or trees. Something important is about to happen.
7 And the Lord God formed man of the dust of the ground, and breathed into his nostrils the breath of life; and man became a living soul.
In order to completely confirm that Adam was made the 3rd Day, Scripture again confirms this by showing that Trees were made AFTER Adam was made.
8 And the Lord God planted a garden eastward in Eden; and there He put the man whom He had formed. 9 And out of the ground made the Lord God to grow every tree that is pleasant to the sight, and good for food; the tree of life also in the midst of the garden, and the tree of knowledge of good and evil.
4. I have Faith that today's scientists, as we near the end, will continue to make discoveries which CONFIRM what is written in Genesis Chapter One. It shouldn't be long until the Rapture and then Armageddon. After all, all those events are certain to take place later on the present 6th Day/Age. Amen?
I just showed you the science that disconfirms your claims. We should find pre-integration sites throughout the human genome. They aren't there.
Correction: Today's Science, which is just now learning what has been in front of their noses for thousands of years, haven't discovered them yet. Hopefully as scientists learn more , they will be able to understand God's Truth instead of thinking that the know more than God. Amen?
1. False. Here are the verses which confirm that God made at least 3 firmaments/Heavens by the 3rd Day.
Notice that they say firmaments/heavens, not multiverses as described by modern theories. Not the same thing.
I know of no one who teaches multiverses (plural). What God shows is that He made at least 3 Universes/firmaments/Heavens within His Multiverse by the 3rd Day, the SAME Day as the Big Bang of our Cosmos. Gen 2:4
2. I post God's Holy Word and my views are His. Haven't you noticed?
They are both the words of men.
False, unless you can show us HOW ancient men, who lived thousands of years before Science, correctly wrote the scientific and historic Truth we find in Genesis Chapter One, which is the entire HISTORY of God's Creation including Future events at the end of the present 6th Day. Gen 1:30
3. Adam was formed of the dust of the ground on the SAME Day as the Big Bang of the present Universe.
Nowhere does it say that in the Bible.
Here it is:
4 These are the generations of the heavens and of the earth when they were created, in the day that the Lord God made the earth and the heavens,
Adam's Earth was made the 3rd Day. Gen 1:9-10 This verse is telling us of other HeavenS (Plural) which were made the 3rd Day. The first Heaven was made the 2nd Day. Gen 1:8 The present Cosmos was made on the 3rd Day, the SAME Day Adam's Earth was made. On this 3rd Day:
5 And every plant of the field before it was in the earth, and every herb of the field before it grew: for the Lord God had not caused it to rain upon the earth, and there was not a man to till the ground. 6 But there went up a mist from the earth, and watered the whole face of the ground.
The plants and trees GREW on the 3rd Day. Gen 1:12 These verses are speaking of the THIRD Day AFTER the Earth was made but BEFORE there were any plants or trees. Something important is about to happen.
7 And the Lord God formed man of the dust of the ground, and breathed into his nostrils the breath of life; and man became a living soul.
In order to completely confirm that Adam was made the 3rd Day, Scripture again confirms this by showing that Trees were made AFTER Adam was made.
8 And the Lord God planted a garden eastward in Eden; and there He put the man whom He had formed. 9 And out of the ground made the Lord God to grow every tree that is pleasant to the sight, and good for food; the tree of life also in the midst of the garden, and the tree of knowledge of good and evil.
4. I have Faith that today's scientists, as we near the end, will continue to make discoveries which CONFIRM what is written in Genesis Chapter One. It shouldn't be long until the Rapture and then Armageddon. After all, all those events are certain to take place later on the present 6th Day/Age. Amen?
I just showed you the science that disconfirms your claims. We should find pre-integration sites throughout the human genome. They aren't there.
Correction: Today's Science, which is just now learning what has been in front of their noses for thousands of years, haven't discovered them yet. Hopefully as scientists learn more , they will be able to understand God's Truth instead of thinking that the know more than God. Amen?
Upvote
0
That isn't the current theory in science.
Those are the words of men. Haven't you noticed?
No mention of the Big Bang.
They have the human genomes. The pre-integration sites aren't there as they should be if your fantasies are true.
Upvote
0
That's because your data goes back to the time when the only people here were NOT Humans (descendants of Adam) and they were filled with the DNA and ERVs of the common ancestor of Apes. When they married Noah's grandsons (descendants of Adam) their children INHERITED the superior intelligence of Adam, gradually, over the past few thousands of years of time RECENTLY, which is within the last 1% of the time since prehistoric man diverged from Chimps.
Your flawed study would see the same inheritance over time as would be produced by nature and today's science obviously cannot tell the difference. Our God is an Awesome God and His Truth will stand when the wisdom of this world is blowing across a burned out Universe. God Bless you
Upvote
0
The data goes back to EVERY GENERATION, from this generation to the one shared with chimps. ALL OF THEM. This is because our genomes are a direct record of all of those generations. If our ancestors had pre-integration sites as you claimed they did, then they should be found in modern genomes. THEY ARE NOT THERE.
Your claims are falsified.
Upvote
0
No, your false accusation is falsified. Since our Human ancestor's (which science cannot distinguish from our prehistoric ancestor's) blood, was contaminated by the ERVs of prehistoric people gradually over the past 10k years, ALL of your data has also been corrupted.
What is shows is the Inability of today's Science to yet determine what God told us in Genesis. It's easy for me to understand but Impossible for someone who THINKS they know more than God. Amen?
Last edited:
Upvote
0
