Why evolution doesn't work.

[Micaiah]

Out of interest have you ever observed the differences between the DNA of the 'ancient' bacteria, and the human genome?

 

[RufusAtticus]

Originally posted by Micaiah
Out of interest have you ever observed the differences between the DNA of the 'ancient' bacteria, and the human genome?

No, but then again I've never observed the differences between my parents' genomes and mine.

 

[Micaiah]

I will be a lot more interested when I've seen someone who has actually studied information theory making the "no new information" argument; for now, I think it's just lack of clear understanding of what "information" is.

You're probably correct. I do my best anyhow. Now let me try, information in this context would refer to the bits and pieces that hang together to make up the chromosomes. All the genetic information for future cells is included in these chromosomes. The bits and pieces that build the DNA chain that form the chromosomes are called nucleotides.

Mutations change the configuration of the DNA. There are a number of different types of mutations including the following:

-point mutations which involve changes to a single nucleotide as a result of copying errors.
-recombination, duplication, inversion, deletion, insertion, and transposition

I understand that your view of evolution will affect your choice of which type of mutation you think is responsible for the changes that have supposedly occured.

Can point mutations result in duplication of nucleotides?

 

[chickenman]

a point mutation isn't a duplication mutation - the thing is that all those types of mutations contribute to evolution

duplication mutations increase the amount substrate upon which point mutations can act - these two types of mutations together can increase complexity

 

[Micaiah]

By the way, can anyone explain the system of blessings and the other things that you see next to your post, or refer me to a place where I can find out about these.

I think I've worked pretty hard to give you people top quality information and deserve a rating. How about it guys?

 

[Micaiah]

“Bacteria and even the oldest eukaryotes (protists) have a rather small genome. . . . This raises the question: By what process is a new gene produced? This occurs, most frequently, by the doubling of an existing gene and its insertion in the chromosome in tandem next to the parental gene. In due time the new gene may adopt a new function and the ancestral gene with its traditional function will then be referred to as the orthologous gene. It is through orthologous genes that the phylogeny of genes is traced. The derived gene, coexisting with the ancestral gene, is called paralogous. Evolutionary diversification is, to a large extent, effected by the production of paralogous genes. The doubling sometimes affects not merely a single gene, but a whole chromosome set or even an entire genome.” [4]

I thought that RufusAtticus could tell me a bit more about the evolution of the ancient bacteria to present day man. You know, how do the changes to the genome occur to produce the variations we see in these lifeforms.

It is my understanding that point mutations are random. Are the other types of mutation listed random?

 

[Risen Tree]

Let me rephrase that.  Show me a complete, unabridged pathway of MACROevolution.

It is the evolution of one species from another, which is what you were previously say didn¡¦t happen. Now you rely on faulty definitions of microevolution and macroevolution to shift your goal post. You can read my sig for the actual definations used in biology. We are discussing science, so lets make sure we stick with using scientific terminology correctly.

Wait a minute, let's not be too hasty.  You need to present empirical evidence that proves that this divergence in the species was caused by mutations (macroevolution) and not fluctuations in the gene pool (microevolution).  Natural selection cannot introduce brand new genes; it can only redistribute and eliminate them.

Well if simple adaptation can change a mosquitoes breeding site, host preference, feeding, egg preference, and life cycle, then ape ancestor to man is rather trivial.

There are COUNTLESS changes that have to occur for a monkey to evolve into a man.  Hasn't this been debated here before?

Not in this case, the populations are reproductively isolated, they won't successfully interbreed.

You mean, not YET.  It hasn't been proven that the two races will not breed with each other at all.  And so what if that state does indeed come about...how does that support macroevolution?  No new genes have been created.

So missing links are pathways that do not exist. Therefore, pathways that do exist are not missing links.

I'm interested in hearing what you have to say, not talkorigins.org.  Besides, those "found links" are just jumps between the genuses.  Where are the individual fossils of the indermediary creatures between the species that you need for evidence?  Are you resorting to blind faith that they do exist?

And thus does not violate 2Lot.

Right, because the life on Earth came from life.  Simple Law of Biogenesis.

How is it an assumption?

Any time one uses the line "But it must be true" or "But we know it to be true," it's an assumption.  You gotta PROVE IT, not assume it.

My vote for irony of the year.

A paradox, I call it.

So it is an assumption to say that science does not involve the supernatural. Right. . . . So demon possession is a scientific explanation for disease. Thor is a scientific explanation of lightning. The devil beating his wife is a scientific explanation of why the sun shines when it rains. Santa Claus is a scientific explanation of why there are presents under the tree on Christmas Morning. Methinks, that you need a refresher course on the scientific method.

Just because some earlier theories on supernaturalism were wrong, in no way refutes the truth of supernaturalism.

First propose a scientific theory. Then we can debate on the evidence for it.

Refer to the first post of this thread.

Can you find a single university with departments or divisions of "junk science," "lab science," and "origin science"?

Nope, they have the respective names of "environmentalism," "natural science," and "paleontology."  BTW this is a discussion topic in and of itself.

Reference please, with specific links to scientific journals that are at the forefront of "Junk Science."

Here's a link.  Or how about this piece of evidence.

Okay, I challenge you to find a single lab in evolutionary biology that does not practice this.

Every one of the fraudulent cases that I mentioned at the beginning of this thread.  Especially the next-to-last one.

If evolution was so unscientific, why is it the foundation of modern biology?

This is a philosophical argument.... Evolution is in practice today, IMHO, because people WANT it to be.  Not because it's scientifically valid.  Case in point: Karl Marx, who readily accepted Darwin's theory by faith and explicitly stated that evolution was a fundamental tenet of the communist theory.

That is over a million chances each generation for any beneficial mutation to occur. Couple that with thousands of generations during the lifetime of a species and you have billions of chances for beneficial mutations to arise. The typical mutation rate of a gene is on the order of 1e-5 to 1e-6 mutations per gene per generation.

Let me rephrase that last sentence to make sure that I got it right.  Any given gene has a 1e-5 to 1e-6 chance of experiencing a mutation per generation, right?  How long is the generation?  What species are we talking about?

It can happen with one mutation. It can happen with millions.

You need a heck of a lot more than one single mutation for evolution of life as we know it to have happened.

Just go through the scientific literature on human and ape chromosome banding patterns. If that doesn't work, you can generate you own by taking samples and following the standard guidlines of cytology.

The thing is, chief, that that picture just doesn't tell the whole story.  First of all, it could just as easily serve as evidence for creation: "Common design, common designer."  Second, it doesn't tell the story about how much work it would take to get those genes to evolve from apes into humans.  See, the evidence for evolution is like somebody with HIV: You know the person is going to die, but sometimes it takes a long time.

 

[RufusAtticus]

Hi Micaiah,

All mutations are random. Most of them occur during DNA replication. A point mutation is simply the replacement of one base with a different base. A deletion is the removal of a base or bases. An insertion is an addition of a base or bases at a spot. A duplication is a specific form of insertion where a new copy of a gene is inserted into a chromosome, it is usually near the original copy.

Original:       AAAATTTT
Point Mutation: AAAGTTTT
Deletion:       AAATTTT
Insertion:      AAAAGTTTT
Duplication:    AAAATTTAAATTT

Now explaing the specific sequence of mutations needed to go from early bacteria to a metazoan is nigh impossible to do with present knowledge especially on a message board. The best chance you have of getting an idea of what the present research finds is keep your eyes on scientific journals. Specifically, Science, Nature, PNAS, Evolution, Molecular Biology and Evolution.

One principal of genetics that accounts for some genomic diversity are the creation of gene families by duplication and divergence, which Mayr mentions in that quote I gave you. One great example of that family are the globin genes. One important duplication and divergence that occured in our history was the one that lead to fetal hemoglobin. This is what allows placental mammals to exist.

 

[chickenman]

"common design, common designer" doesn't work for pseudogenes risingtree, because pseudogenes clearly aren't designed, and yet they follow the same patterns of common ancestry as functional genes

 

[Risen Tree]

What is a "pseudogene?"

 

[RufusAtticus]

Originally posted by Rising Suns:
Let me rephrase that. Show me a complete, unabridged pathway of MACROevolution.

Nice shift of goalposts. How about I ask you a similar question? Show me the complete unabridged pathway of your descent from Adam and Eve. Unless you can do that, there is no possible way for you to be their descendent.

Wait a minute, let's not be too hasty. You need to present empirical evidence that proves that this divergence in the species was caused by mutations (macroevolution) and not fluctuations in the gene pool (microevolution). Natural selection cannot introduce brand new genes; it can only redistribute and eliminate them.

Mutation introduces new genes, I don’t know why you are bringing up selection here. Remember that thing I said about using scientific terminology correctly, perhaps you should start doing it. Macroevolution versus microevolution are not associated with specific evolutionary forces. Showing speciation and divergence is enough to demonstrate macroevolution.

There are COUNTLESS changes that have to occur for a monkey to evolve into a man. Hasn't this been debated here before?

Really? What is your source on this? Last scientific estimates I saw were around 1000 mutation events.

You mean, not YET. It hasn't been proven that the two races will not breed with each other at all. And so what if that state does indeed come about...how does that support macroevolution? No new genes have been created.

Sigh. Read the paper before you insist on what hasn’t been shown yet. (Hint: It does show that they don’t interbreed.) Argumentum ex ignoratia is no way to operate on a scholarly level. Unless you want to propose a biological mechanism for reuniting two significantly, genetically distinct populations after they have become incapable of interbreeding, their divergence is permanent.

I'm interested in hearing what you have to say, not talkorigins.org.

Fine, then I tell you to go read about the make up of the fossil record from scientific sources, like the Journal of Paleontology.

Besides, those "found links" are just jumps between the genuses.

Ooo, the Gish gallop: Every found link produces two more missing ones.

Where are the individual fossils of the indermediary creatures between the species that you need for evidence?

See my foram example for evidence of gradual speciation.

Right, because the life on Earth came from life. Simple Law of Biogenesis.

Ahh, so 2lot no longer disproves evolution, only abiogenesis. Then I quess you no longer have any problems with universal common descent.

Any time one uses the line "But it must be true" or "But we know it to be true," it's an assumption. You gotta PROVE IT, not assume it.

Prove what? You have yet to tell me what assumption of mine you are referring too. I suspect that there isn’t one, and you are being intentionally vague because you are desperate.

Just because some earlier theories on supernaturalism were wrong, in no way refutes the truth of supernaturalism.

The truth of supernaturalism is not what is a stake here. It is the fact that supernaturalism is not part of science since science relies on the falsifiable. For example, you can’t disprove that the universe was begun last Thursday, complete with all our memories and the appearance of past events. Yet you would have such an idea qualify as scientific. I’m still waiting for you to propose a scientific theory. Your previous attempt failed because it relies on supernatural intervention as an explanation. “Goddidit” is not a scientific explanation.

Nope, they have the respective names of "environmentalism," "natural science," and "paleontology." BTW this is a discussion topic in and of itself.

Good, so you agree that evolutionary biology is natural science since it does not fit into either other category. What then is your problem?

Here's a link.  Or how about this piece of evidence.

I ask you for links to scientific journals and all that you can come up with is an Ayn Rand site and a rant about environmentalists. If this is what you think constitutes a scientific journal, then I got some prime swamp-front property to sell you.

This is a philosophical argument.... Evolution is in practice today, IMHO, because people WANT it to be.

That’s funny, considering that creationists are always claiming, via public polling, that people don’t want it to be. Which part of the contradiction is true?

Not because it's scientifically valid.

Nice assertion. What qualifies you to say it is not scientifically valid aginst the overwhelming opinion of the scientific community?

Case in point: Karl Marx, who readily accepted Darwin's theory by faith and explicitly stated that evolution was a fundamental tenet of the communist theory.

Really? You wouldn’t happen to have a reference to where he states that in his work. I suspect that you do not and are just blowing smoke. The reality of history records that the communists actually rejected Darwin’s theories because they were too capitalistic. Under the pressure of Stalin, Russian biology adopted a communist view of biology, Lysenkoism, and still hasn’t recovered from the damage it brought.

Let me rephrase that last sentence to make sure that I got it right. Any given gene has a 1e-5 to 1e-6 chance of experiencing a mutation per generation, right? How long is the generation? What species are we talking about?

Neither matter. That range of rates is typical across biology.

The thing is, chief, that that picture just doesn't tell the whole story. First of all, it could just as easily serve as evidence for creation: "Common design, common designer."

No intelligent designer would put non-human telomeres (recognizable ends of chromosomes) in the middle of our chromosome 2. But that is what is precisely expected to be there if our chromosome 2 was the result of a fusion of two ancestral chromosomes. “Common sentient designer” isn’t an explaination, unless you can provide a method to distinguish between design and descent. For example, common designer makes paternity test unreliable: “Your honor, that child isn’t mine since any similarities we share are the result of a common designer and not my prior relationship with his mother.”

Second, it doesn't tell the story about how much work it would take to get those genes to evolve from apes into humans.

What work? Nothing was trying to evolve into humans. We are just one of many possible outcomes of mutation plus natural selection, drift, and migration.

See, the evidence for evolution is like somebody with HIV: You know the person is going to die, but sometimes it takes a long time.

The reports of evolution’s death have been greatly exaggerated for over a hundred years.

 

[RufusAtticus]

Originally posted by Rising Tree
What is a "pseudogene?"

A textbook defination (literally): a nonfuctional member of a gene family.

 

[Micaiah]

One principal of genetics that accounts for some genomic diversity are the creation of gene families by duplication and divergence, which Mayr mentions in that quote I gave you. One great example of that family are the globin genes. One important duplication and divergence that occured in our history was the one that lead to fetal hemoglobin. This is what allows placental mammals to exist.

I asked for an example of genetic change that could have occured, and you have given me a possible scenario. I do not have the expertise to verify or discredit the example. Thanks any how. Others may wish to comment.

 

[RufusAtticus]

Originally posted by Micaiah
I asked for an example of genetic change that could have occured, and you have given me a possible scenario. I do not have the expertise to verify or discredit the example. Thanks any how. Others may wish to comment.

Hi Micaiah,

Since you appear to be very curious about my example, I'll give you some more information on it.

Fetal Hemoglobin (Hemoglobin F) Fact Sheet (From the State of Maryland)

The Evolution of a Scientist (contains some Hemoglobin information in the middle)

Genetic Variation and Natual Selection

I ran the sequences of human beta (adult), gamma (fetal), and epislon (embryonic) hemoglobin into an alignment program and it produced the following results. The "-" refer to insertions/deletions. And the "*" refer to nucleotides that are identical in all three genes. Note how the central regions are the most conserved. Now if you want I can do a comparason of these genes with their homologs in our closest relatives, assuming I can find the sequences.

CLUSTAL W (1.82) Multiple Sequence Alignments



Sequence format is Pearson
Sequence 1: HBB             626 bp
Sequence 2: HBE1            815 bp
Sequence 3: HBG1            584 bp
Start of Pairwise alignments
Aligning...
Sequences (1:2) Aligned. Score:  73
Sequences (1:3) Aligned. Score:  63
Sequences (2:3) Aligned. Score:  71
Guide tree        file created:   [/ebi/extserv/old-work/500408.115265.dnd]
Start of Multiple Alignment
There are 2 groups
Aligning...
Group 1: Sequences:   2      Score:9143
Group 2: Sequences:   3      Score:8520
Alignment Score 8825
CLUSTAL-Alignment file created  [/ebi/extserv/old-work/500408.115265.aln]

CLUSTAL W (1.82) multiple sequence alignment


HBB             ------------------------------------------------------------
HBE1            CAACAAAAAAGAGCCTCAGGATCCAGCACACATTATCACAAACTTAGTGTCCATCCATCA 60
HBG1            ------------------------------------------------------------
                                                                            

HBB             ------------------------------------------------------------
HBE1            CTGCTGACCCTCTCCGGACCTGACTCCACCCCTGAGGACACAGGTCAGCCTTGACCAATG 120
HBG1            ------------------------------------------------------------
                                                                            

HBB             ------------------------------------------------------------
HBE1            ACTTTTAAGTACCATGGAGAACAGGGGGCCAGAACTTCGGCAGTAAAGAATAAAAGGCCA 180
HBG1            ------------------------------------------------------------
                                                                            

HBB             -------------------ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAA 41
HBE1            GACAGAGAGGCAGCAGCACATATCTGCTTCCGACACAGCTGCAATCACTAGCAAGCTCTC 240
HBG1            -------------------ACACTCGCTTCTGGAACGTCTGAGATTATCAATAAGCTCCT 41
                                   * *   ***** *  **  ***   * *  *  ** ***  

HBB             A---CAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGG 98
HBE1            AGGCCTGGCATCATGGTGCATTTTACTGCTGAGGAGAAGGCTGCCGTCACTAGCCTGTGG 300
HBG1            AGTCCAGACGCCATGGGTCATTTCACAGAGGAGGACAAGGCTACTATCACAAGCCTGTGG 101
                *   * * *  *****  **  * **    ***** *** ** *  * **   *******

HBB             GGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTAC 158
HBE1            AGCAAGATGAATGTGGAAGAGGCTGGAGGTGAAGCCTTGGGCAGACTCCTCGTTGTTTAC 360
HBG1            GGCAAGGTGAATGTGGAAGATGCTGGAGGAGAAACCCTGGGAAGGCTCCTGGTTGTCTAC 161
                 ***** **** ***** ** * *** ** **  ** **** ** ** ** ** ** ***

HBB             CCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATG 218
HBE1            CCCTGGACCCAGAGATTTTTTGACAGCTTTGGAAACCTGTCGTCTCCCTCTGCCATCCTG 420
HBG1            CCATGGACCCAGAGGTTCTTTGACAGCTTTGGCAACCTGTCCTCTGCCTCTGCCATCATG 221
                ** *********** ** *****   ******  * *****  ** *   ***  *  **

HBB             GGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTG 278
HBE1            GGCAACCCCAAGGTCAAGGCCCATGGCAAGAAGGTGCTGACTTCCTTTGGAGATGCTATT 480
HBG1            GGCAACCCCAAAGTCAAGGCACATGGCAAGAAGGTGCTGACTTCCTTGGGAGATGCCATA 281
                ******** ** ** ***** *********** *****   * ****  * ****   * 

HBB             GCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAG 338
HBE1            AAAAACATGGACAACCTCAAGCCCGCCTTTGCTAAGCTGAGTGAGCTGCACTGTGACAAG 540
HBG1            AAGCACCTGGATGATCTCAAGGGCACCTTTGCCCAGCTGAGTGAACTGCACTGTGACAAG 341
                    ** ****  * ******  * *******    ******** ***************

HBB             CTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCC 398
HBE1            CTGCATGTGGATCCTGAGAACTTCAAGCTCCTGGGTAACGTGATGGTGATTATTCTGGCT 600
HBG1            CTGCATGTGGATCCTGAGAACTTCAAGCTCCTGGGAAATGTGCTGGTGACCGTTTTGGCA 401
                ***** ******************* ********* ** *** ****     *  **** 

HBB             CATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCT 458
HBE1            ACTCACTTTGGCAAGGAGTTCACCCCTGAAGTGCAGGCTGCCTGGCAGAAGCTGGTGTCT 660
HBG1            ATCCATTTCGGCAAAGAATTCACCCCTGAGGTGCAGGCTTCCTGGCAGAAGATGGTGACT 461
                   ** ** ***** ** ********    ********* ***  *****  ***** **

HBB             GGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTT 518
HBE1            GCTGTCGCCATTGCCCTGGCCCATAAGTACCACTGAGTTCTCTT---------CCAGTTT 711
HBG1            GCAGTGGCCAGTGCCCTGTCCTCCAGATACCACTGAGC-CTCTTGCCCATGATTCAGAGC 520
                *  ** ** * ******* **   *  ** **** **  * ***          **    

HBB             CTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGG 578
HBE1            GC---AGGTCTTCCTGTGACCCTGACACCCTCCTTCTGCACATGGGGA--CTGGGCTTGG 766
HBG1            TTTCAAGGATAGGCTTTATTCTGCAAGCAATACAAATAATAAATCTATTCTGCTGAGAGA 580
                     *       ** *   *   *       *   *                 *   * 

HBB             CCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC- 626
HBE1            CCTTGAGAGAAAGCCTTCTGTTTAATAAAGTACATTTTCTTCAGTAATC 815
HBG1            TCAC--------------------------------------------- 584
                 *

 

[lithium.]

Originally posted by Micaiah
Seeya Seesaw. Thanks for the chat. Maybe you could answer another time. Time for me to go as well.

What did you want me to answer?

 

[lithium.]

Hi Guys I'm back. I just couldn't let this one slide.

Heh it's about time.

 

[Micaiah]

Hmmm. Interesting. It is fascinating to me the way the DNA changes in the hemoglobin. These changes are evidently not random. 'Mutations' occur to suit the needs of the baby at different stages of development. This confirms my understanding of insertions and deletions as given in the book by Lee Spetner who states such changes to the DNA are not random, and they operate on a segment of the DNA. So bits of the DNA can be cut out and reinserted with incredible precision to form a new sequence that suits a particular set of circumstances.

That type of 'mutation' would be quite different I expect to the single nucleotide substitution required in the Neo Darwinian Theory of evolution. Do you know if insetions and deletions can result in changes to single nucleotides only? By the way, do you support the punctuated equilibrium or the NDT version of evolution.

I note that the example given on the evolution of the hemoglobin is a possible explanation or theory. I wouldn't call it scientific fact.

 

[RufusAtticus]

Originally posted by Micaiah
Hmmm. Interesting. It is fascinating to me the way the DNA changes in the hemoglobin. These changes are evidently not random. 'Mutations' occur to suit the needs of the baby at different stages of development. This confirms my understanding of insertions and deletions as given in the book by Lee Spetner who states such changes to the DNA are not random, and they operate on a segment of the DNA. So bits of the DNA can be cut out and reinserted with incredible precision to form a new sequence that suits a particular set of circumstances.

Oh no. I'm sorry I didn't make the situaiton more clear. These proteins are coded by three seperate genes. The transition between them is due to regulation, not mutations. The genes turn on and off due to developmental cues.

That type of 'mutation' would be quite different I expect to the single nucleotide substitution required in the Neo Darwinian Theory of evolution. Do you know if insetions and deletions can result in changes to single nucleotides only?

Hmm? Point mutations, insertions, and deletions all happen. So I don't understand why exactly you're asking the question.

By the way, do you support the punctuated equilibrium or the NDT version of evolution.

I support both theories. PuncEq is not a replacement nor an elaboration of NDT. It is an application of NDT to paleontology, and it explains the patterns seen in the fossil record. It is a very common misconception, even amongst biologists, to think that PuncEq is a new theory of evolution.

I note that the example given on the evolution of the hemoglobin is a possible explanation or theory. I wouldn't call it scientific fact.

The facts are the different forms of globins, how similar they are, their functions, and their distribution across species. You have only been presented with a small sample of the large pool of knowledge that let's scientists conclude what went on in the evolution of hemoglobin.

 

[Micaiah]

G'day Seesaw,

I'm just here for a small time. You got your question in before I finished my post.

Probably a bit of an unrealistic question in hindsight. I requested your explanation of how things came to be the way they are. You know, how did we get here?

The point I made yesterday was that whichever tack you take - God the Creator, or everything coming from nothing, (or aliens), there is a ceratin amount of faith required.

If you rule out the possibility of a God, then any explanation you of observable facts will tend to align with your faith ie. no God, things just came into existence. Both the Christian and the athiest see scientific evidence through their own filter.

 

[RufusAtticus]

Originally posted by Micaiah
Both the Christian and the athiest see scientific evidence through their own filter.

But what happens when the scientific community, which consists of Christians, Atheists, Agnostics, Jews, Muslims, Hindus, Buddhists, etc., can come to a concensus? Do you toss out the views of these professionals?