The Coccyx

[pshun2404]

Wait as long as you like. I sometimes continue playing when the goal posts are shifted. I don't play when the game moves from Wembley to Hampden.

I didn't think so!

"Of course we don't. That's the whole point. It was once greater, or more noticeable in our ancestors" is the same default tactic I often to used (laughing inwardly thinking "Duh...its so obvious" until I tried to prove it)! Even the possibly human earliest ancestors like Heidelbergensis and Erectus had no tails.

Since you brought the ball to the other court skipping the monkeys (that no one says we are descended from) can you show us even one ape fossil we are related to from 14 million years ago (or even 8), that has a tail...or is this claim just more sci fi?

 

[pshun2404]

Yup...an assumption based conclusion with nothing to support it... after all such a man made story fits the hypothesis! Oh well you went there...

 

[tas8831]

When you say "same results", are you referring to the 'the same ERV, in the same location',
or 'the same inactivation mutations'?

I am agreeing that this may not have happened via “two separate infections” but the same infection, which occurred in the same area around the same time. So let us say that 250,000 ya a serious viral infection spread all through the jungle effecting chimps and humans living there at that time, maybe even killing off some other creatures.

This is just word salad.

In all your time in Biotech, you never learned how a retrovirus operates?

Both being primates their systems dealt with them the same way and inactivated them by using similar mutations to cause them to cease their effect (in other words their genome did this).

How does a 'system' deactivate an ERV?

You are using an awful lot of ASSUMPTIONS here.

Now this may be random (but I will not be dogmatic about that) or may be via the program of the DNA to accomplish this goal (to preserve its integrity as much as possible).

So why are other ERVs not inactivated in the same way? And why are so few other ERVs inserted at the same locus, when their integration sites are, literally, all over the genome?

What are your calculated probabilities for these events such that you can just chalk it up to coincidence?

Similar systems of DNA re-arrangement nay have place them in this exact spot (to use it or render it useless).

May have.

Or may not have.


This is no 'explanation' - this is Occam's nightmare.

 

[tas8831]

Please EXPLAIN, without copy-pastes or doctored quotes, HOW, exactly, a viral genome could be inserted at the exact same locus in a chromosome of 2 different species (given that the target integration sites are literally all over the genome*), AND possess the same inactivation mutations, purely randomly.

I just did that...only allowing the possibility of randomicity without assuming it was.

That is not an explanation. You are capitulating and you don't even see it.

Next I said "In my humble opinion because researchers seek these alleged ERVs out to form or improve phylogenetic trees, lineal relationship is already a pre-supposed reality before they look (which biases the interpretation)."Sorry but this is true!

No, it is not true.

That is your projected assumption.

Was there ever a time when you did not assume lineal relationship even long before you started reviewing evidence as interpreted this way?

Please stop projecting.

When I chose loci to sequence and compare, I had no way of knowing - or even assuming - what the outcome of the analyses might be.

Of course not because you were taught it was true already (just as I was and my father before me).

What a person believes will not dictate the outcomes of analyses, no matter how much you assume this to be the case (or perhaps you are just projecting again).

Do you feel the same way about the earth being a sphere? Is that "belief" accepted solely because we were taught it was true (by.....?)?


Do you accept any scientific concept? Or is only evolution on your list of things to cast doubt on because 'we were taught it was true'?

Darwin, and then all his followers, believed it and accepted it as true, long before they had any of this.

Yes - because even Darwin had sufficient evidence to convince sensible, intelligent, relevantly-educated skeptics. AND he proposed a viable mechanism.


I know you ascribe to the hackneyed, sad notion that these are just people looking for a reason to reject God - but that is, pardon me, Horse crap. Even educated creationists state outright that evolution is a viable scientific theory and that there is EVIDENCE for it:

The truth about evolution

I hope this doesn't turn into a rant, but it might. You have been warned.

Evolution is not a theory in crisis. It is not teetering on the verge of collapse. It has not failed as a scientific explanation. There is evidence for evolution, gobs and gobs of it. It is not just speculation or a faith choice or an assumption or a religion. It is a productive framework for lots of biological research, and it has amazing explanatory power. There is no conspiracy to hide the truth about the failure of evolution. There has really been no failure of evolution as a scientific theory. It works, and it works well.

I say these things not because I'm crazy or because I've "converted" to evolution. I say these things because they are true. I'm motivated this morning by reading yet another clueless, well-meaning person pompously declaring that evolution is a failure. People who say that are either unacquainted with the inner workings of science or unacquainted with the evidence for evolution. (Technically, they could also be deluded or lying, but that seems rather uncharitable to say. Oops.)

Creationist students, listen to me very carefully: There is evidence for evolution, and evolution is an extremely successful scientific theory. That doesn't make it ultimately true, and it doesn't mean that there could not possibly be viable alternatives. It is my own faith choice to reject evolution, because I believe the Bible reveals true information about the history of the earth that is fundamentally incompatible with evolution. I am motivated to understand God's creation from what I believe to be a biblical, creationist perspective. Evolution itself is not flawed or without evidence. Please don't be duped into thinking that somehow evolution itself is a failure. Please don't idolize your own ability to reason. Faith is enough. If God said it, that should settle it. Maybe that's not enough for your scoffing professor or your non-Christian friends, but it should be enough for you.​

Wood has a PhD in Biochemistry and was a founder of the Baraminology Study Group and is a professor at Bryan College.

Remind us all again how your knowledge and experience trumps his?

And this pre-held conviction biases interpretation no less than does the pre-held convictions of a Ken Ham bias his.

And what were his pre-held convictions, and how do you know?

Sure, bias can color interpretation - but spin can only do so much.

You will have all believe that ALL evidence for evolution is merely assumption and bias and conspiracy.

And with your self-proclaimed expertise in brainwashing, one can draw their own conclusions as to why you do this.

 

[tas8831]

The index card on which I wrote down the codes for the 24 taxa is still hanging on my office wall, yellowed and curling on the edges. It was about 14 years ago.

He refused to test his creationist hypothesis.

Would YOU take the challenge? I will have to update the format of the old file - do you use FASTA in your DNA analyses?

No! I do not have the time.

LOL!

I thought you worked in Biotech - are you implying that you don't know how to do these simple procedures, that it would take too much time?

What a spectacular COP OUT!

You seem to have all kinds of time to write excessively verbose replies to questions that could be answered with a sentence or two - but no time to put your money where your mouth is!

Oh man...

But if YOU sometime in the future just take the natural human genome as it is and the natural chimp genome as it is (un-effected by ANY machinations of man including any intelligently designed programs) and then starting at any earliest point one quickly comes upon a difference that throws the whole thing in stark difference for the remainder of the 3000000000 pairs. At very few places do they naturally agree. And this makes sense to me because they are totally different creatures and I no longer assume they are long lost cousins.

I love the smell of desperation and dodging in the morning.



And the line about "intelligently designed programs"?

A sad and Hilarious CLASSIC YEC escape clause!


I first encountered that pathetic antic in Randy Wysong's 'The Creation Controversy'. One of the first creation books I had read. He declared, oddly, that life HAD been created in the lab (and this was back in the mid 1970s!), but that it was not evidence for evolution because the scientists had added "KNOW HOW" (caps in the original).

This is what you are doing - those scientists with their man-made programs adding KNOW-HOW to the mix! Great way to dismiss anything you don't like.

Well, providing you don't want to be trusted as an honest broker or taken seriously.

 

[tas8831]

But since you bring it up - please explain, exactly, what you mean by "their value regarding truth".

Carefully re-read the response in full...I already did that! When the program is designed to align like sequences the differences between the two compared are just DIFFERENCES. They do not need to be explained (only if one has become stuck on an answer before the question was asked).

That has nothing to do with 'truth' - you sure like to take credit for things you've not done.

What I am seeing here is the over-confident writing of a person that does not understand how these programs operate.

It is easy to dismiss these when you refuse to update your knowledge base - of course, I remember that you were one of the many that dismiss the Atchley and Fitch and Hillis papers because the 'mice were still mice'...

When one has additional data the other does not it need not be INTERPRETED as being inserted at some later or earlier time when we actually have no evidence it happened.

The evidence is in the polarity one can observe when analyzing the sequences.

You are simply dismissing that which you do not understand.

Likewise, the imaginary gaps it MUST create to get a match ACTUALLY are NOT there (so they need not be explained...unless one needs to do this so it can fit into the interpreter’s presupposition).

Duane Gish could not have said it better! In fact, he said nearly the exact same thing back in the 1980s!

When you said you worked in Biotech - was it as the ICR?

Do you even understand why gaps are used?

EXPLAIN it to me, so I know whether you are operating out of ignorance or malice.

So the tool...the instrument and data...are amazing and valuable but the conclusions drawn are sometimes skewed. That’s the truth. The presupposition dominates the data instead of the other way around. No conspiracy to do so just a lack of objectivity...

The real truth is that you have a very cynical and biased and skewed view of how these tools are used.

So please outline how these packages operate - how the outcomes of their analyses can be apparently pre-biased. I am especially curious to understand how the authors could pre-bias their outcomes despite the fact that they have no idea what the inputs will be.

The actual data the program reveals is NOT itself pre-biased (I thought I have made that clear more than once so I will explain it again...hopefully last time)

Because they already a belief as truth going in

WHAT TRUTH???

That mutations happen?

Are you disputing that?


That germline mutations can be passed on the offspring?

Are you disputing that?


That mutations that are passed on can accumulate in descendants?

Are you disputing that?


That these patterns of mutations can indicated kinship?

Are you disputing that?


Or are you just "disputing" the outcomes of analyses that are premised on these simple, known facts because they lead to places that you have been brainwashed to reject?

this biases their interpretation of what the data MEANS (the actual results are just what they are). I cannot make that any clearer. My position is let the data simply be the data, and let IT speak for itself.

That is what is done.


You simply refuse to accept the fact that your belief system cannot find unbiased support in the real world, and so you lash out and hurl accusations that you cannot even begin to back up.


You cannot make it any clearer because it is solely your uninformed ASSUMPTIONS.

You clearly have no idea.

One very different creature has the 123456, and the other unique and unrelated creature has 123987431456. That is what actually IS. No story need be invented to explain this. The actual data does not show any progression over time just that the two creatures ARE IN FACT different creatures.

All your years in Biotech, and you are not familiar with the act of insertion? Transposition?

Can it really be your position that if we compare 2 human relatives, and 1 of them has at locus X, 123456, and the other human has at locus X 123987431456, that YOUR 'unbiased' conclusion would be that they are different creatures? Because the data just IS that there is this difference, and we CANNOT conclude that the 2nd one has an insertion between 123 and 456?

REALLY????

I cannot grasp that such an intelligent person as yourself has a mind so fixed that it cannot process the reality and separate it from the story told that interprets according to the presupposition?

Are you familiar with the Dunning-Kruger effect?

That is what we see in people that, for example, clearly do not understand basic genetics phenomena, nor understand how DNA sequence analysis software works, yet deign to condescend from on high about how it is all a scam due to bias and that it is everyone else that does not understand.

And I find it very, VERY telling that you apparently either cannot understand that YOU 'interpret' things base don your own presuppositions, or that you think your presuppositions are somehow objectively true and all others are false.

Do you even know what the general presuppositions of reality-based, scientific naturalism are?

 

[tas8831]

But...with the coccyx we have ZERO evidence that in humans (or apes for that matter) they were anything other than what they are, right now.

NO evidence of degeneration from more to less anywhere!

NO evidence they were once there as tails that atrophied over time!

Actually, we have the extensor coccygis.

It originates on the distal sacrum and inserts o the proximal coccyx. Its fibers run parallel to the vertebral column. as such, the ONLY thing that this muscle would be able to do it to extend the coccyx (hence its name).

But it cannot do so.

And not everyone even has it.

Is this some Grand Design?

An example of a perfect Creation? A muscle that not everyone has, and in those that do, it does nothing?

Hmmm....

AND we have definite CONFIRMABLE, OBSERVABLE, TESTABLE EVIDENCE that the coccyx HAS FUNCTION!

Right. it is associated with structures next to/on it.

And yet, there is a condition called caudal agenesis in which the coccyx does not form ( sometimes along with parts of the sacrum). This is typically asymptomatic.

If the coccyx is so darned important, why can being born without one usually go unnoticed?

So are you saying we should accept the unfounded baseless supposition as truth and not rest oour conclusions on the confirmable, observable, testable evidence?

How do you test that the coccyx is NOT a reduced caudal vertebral tail?

How do you confirm this?

Do tell!

Let’s see which will I place my trust in? Hmmm? Sorry the reality beats the Sci Fi...NO the coccyx was never a tail! The same area of the anatomy of these very distinct and different creatures demonstrates their unrelated difference...nothing more...and that is reality.

That looks to me more like the ASSUMPTION of a novice.

How much anatomy did you study in biotech?

We saw with the whole elephant clavicle thing that it took post after post, repeated links to sites you claimed to already have visited and used, repeated explanations as to how shoulder anatomy actually works, for you to finally admit to your error - and that was with pictures and textual explanations from 3rd parties!

No one is under the illusion that you will actually admit to something that you are so entrenched in believing is not true, but some bits of evidence cannot be ignored just because they go against your assumptions.

 

[tas8831]

b) because the coccyx is known to be there to support a ganglia of nervous tissue covered in grey matter (like a little brain - coccygeal plexus) and not only is the connective source of the two coccygeal and also sciatic nerves, but assists (and is necessary to) the autonomic urogenital functions.

Wow... Um, no - a ganglion is not like a little brain.
They consist of either the cell bodies of unipolar (sensory) neurons), whose job is simply to relay impulses, or lower motor neuron cell bodies, whose job is to relay motor impulses.


And no, the coccygeal plexus is NOT a ganglion (where do you come up with this nonsense?).

A plexus is basically a network of nerve fibers. The coccygeal nerves do not act as "connective sources" for the sciatic nerves (whatever that means) - observe this diagram from Gray's:

Spinal nerve - Wikipedia


Almost your entire depiction of the coccyx seems premised on little more than wishful thinking, and the embellished function of it is clearly founded on extrapolations of assumptions of someone wholly unfamiliar wit anatomical terminology.

In its parasympathetic stimulated phase

What on earth does that even mean?

Tell me exactly how a BONE can be stimulated by the parasympathetic nervous system?

For crying out loud, the coccygeal ganglion is a SYMPATHETIC gangion!

it is essential to our sexuality, thus mating, thus perpetuation and survival of the species.

LOL!

Are you serious! No, you cannot be - this HAS to be a joke, something you copied from a Poe or a troll without knowing any better.

PROBLEMS with the coccyx can produce pain during intercourse, but that is the opposite of what you claim!

It carries the sensation/information through the axons to the central nervous system and back through transmission across the dentrites.[sic]

O M G.


This is freshman biology.

The direction of nerve impulse transmission in a neuron is dendrite - cell body - axon.

The coccygeal nerve would exist WITHOUT the coccyx, since the coccygeal nerves originate on the spinal cord, which terminates way up around L2.

Look - I get that you really really really need evolution to be false.

I get that somewhere along the line, you were told you were super duper extra smart, and to use that super human knowledge to defeat evolution. And I get that you consider your lines of argumentation impeccable and see yourself as an unbiased logician and all that -

but dude...

You are almost 100% clueless about this stuff.

The OP of this thread looks like it was written by a 9th grader. And this is the best you can muster on this topic?

 

[pshun2404]

Thanks TAS...I really appreciate all that wind!

 

[pshun2404]

Ignoring most of that opinion about my person and intelligence

That mutations happen?
Are you disputing that?

Of course not...indeed they do!

That germline mutations can be passed on the offspring?
Are you disputing that?

That’s how we inherit them...human babies inherit GERMLINE mutations from their human parents.

That mutations that are passed on can accumulate in descendants?
Are you disputing that?

Not at all.

That these patterns of mutations can indicated kinship?
Are you disputing that?

Germline mutations do indicate kinship! Only there are no germline mutations between apes and humans! In fact there are no GERMLINE mutations between most types of apes, though some apes do have similar mutations with other apes, and even with some monkeys, and humans also share some of these similar mutations but they are not inherited from one another.

All your years in Biotech, and you are not familiar with the act of insertion? Transposition?

Sure I am but the fact is mostly all alleged “insertions” have never actually been shown to have been inserted. They are simply there in one unique creature and not there in another unique creature. In these cases (most idels fall into this category) it is just as likely these are just the normal parts of that creature’s genome. I have been through this before in another thread.

And I never referred to both patterns being in two humans...I said when we compare the genomes of two different creatures the program automatically creates these gaps (in order the “ALIGN” similar sequences) which is then interpreted as insertions or deletions (whichever is convenient). In the creatures themselves these gaps DO NOT EXIST. The actual genome has these as differences and the program ignores these as contrary to its purpose of finding and establishing areas of similarity (that’s its purpose). Are you disputing that?

 

[pshun2404]

How do you test that the coccyx is NOT a reduced caudal vertebral tail?

How do you confirm this?



To begin with you cannot prove a negative but we can do something...observe! Observable fact is what science can test unquestionably and the speculative is fine but conclusions can rarely be absolute. So what does observation teach us?


It teaches us that there is no noticeable vestigiality of a tail in the human germline since the earliest humans ever detected.


It teaches us that there is no noticeable vestigiality of a tail in the chimp germline since the earliest chimps ever detected.


It teaches us that there is no noticeable vestigiality of a tail in any of the other alleged great ape germlines since the earliest other apes can be detected.


Thus NO actual reason to attribute any truth value to the belief it is so. Now yes there is a default to the ancestor of the gaps argument but NO ONE has ever seen or found such a creature and no one can show one example even from the remote past. And even if they could be specific, that does not guarantee that one came from the other.


So the logic of the actual data (above) and the narrative (attached to fit the theory) do not match up. The made up story does not find indication in the real data.

 

[tas8831]

Thanks TAS...I really appreciate all that wind!

And thus to dodging/blow off begins.

Off to a meeting, but it will be great entertainment, to say the least, to see how you try to wriggle out of this latest string of embarrassments -and, of course, try to turn it around on me.

it will also be a blast to see how must you omit in your replies.

ta ta!

 

[pshun2404]

Didn't even read the responses and yet make such a statement? I dodged nothing of value...

Read posts 230 and 231...

 

[tas8831]

For reference:


How do phylogenetic tree programs work?

 

[pshun2404]

For reference:


How do phylogenetic tree programs work?

You asked for a response to your points and yet are avoiding the logic and content of my responses. I already read this when you formerly posted the link and already know all of that explanation...now address the responses or will you bow out as Oph did when he KNOWS he could not address the logic and content of the "ancestors" point?

Apparently sound reasoning is not allowed if it disagrees with the presupposition! IMO this hinders real progress in scientific thought (which should remain open to other possibilities).

I understand fully HOW these programs work and what they intend to do. They do it well. They succeed in aligning like-sequence sections of the comparative genomes. but THEN the persons interpreting the data interpret it according to their presupposition (that there is a lineal relationship between different creatures and I did not say here between two humans or two chimps which is obvious).

If and when two genomes are simply lined up next to each other (without the alignment program), they are very very different (each creature having its own unique continuous sequence).

To rightly and objectively claim an insertion one must SHOW it was inserted (hence that it was not there in the original and now is). To claim it is a deletion one must SHOW it was deleted (that it was originally there and now is not). Otherwise it is a possible explanation ONLY and not a fact.

 

[tas8831]

That mutations happen?
Are you disputing that?

Of course not...indeed they do!

That germline mutations can be passed on the offspring?
Are you disputing that?

That’s how we inherit them...human babies inherit GERMLINE mutations from their human parents.

That mutations that are passed on can accumulate in descendants?
Are you disputing that?

Not at all.

That these patterns of mutations can indicated kinship?
Are you disputing that?

Germline mutations do indicate kinship! Only there are no germline mutations between apes and humans!

ASSUMING that which you want to believe.

I believe that I have, on several occasions, provided three citations indicating the reliability of methods used to assess hypotheses of phylogeny. And on the occasions that you have deigned to respond to them, you, like all other creationists thus far, simply dismissed them because the 'mice were still mice', totally ignoring (on purpose) the reason those citations were posted AND what they actually indicate.

In fact there are no GERMLINE mutations between most types of apes, though some apes do have similar mutations with other apes, and even with some monkeys, and humans also share some of these similar mutations but they are not inherited from one another.

What is your EXPLANATION as to why we can assess mutational patterns within groups, but not outside of those groups? Do you not accept that insertions or deletions can occur in the germline? If not, why not?

At what point do these analyses become suspect, in your oh so educated and informed opinion?

That is, when looking at germline mutations and inheritance, what, exactly, prevents these analyses from being used to compare different taxa?

All your years in Biotech, and you are not familiar with the act of insertion? Transposition?

Sure I am but the fact is mostly all alleged “insertions” have never actually been shown to have been inserted.

That is a fact?

Are you saying that all the things considered to be indels in human genomes are not really indels?

Or just when comparing different taxa?

Thus you negate your earlier statement - sure you understand insertions, but no, the things actual geneticists and the like see as insertions are not because they have not been shown to be?


You must know that any 2 human genomes differ by many millions of bps, yes? And that this includes one person possibly having a larger genome than another, yes?

If you accept that insertions occur, how, EXACTLY does pshun2404 determine whether or not what we see in a DNA sequence is or is not the result of insertion/deletion?

Funny - hundreds of thousands of degreed professional geneticists, population geneticists, evolutionary biologists, etc. can do this, yet pshun2404 the autodidact claims otherwise.

Please EXPLAIN your position, and support it with something beyond a couple of sentences or analogies or omissions.

They are simply there in one unique creature and not there in another unique creature.

Just so stories are so precious.

But not evidence, rationale, or explanation.

Show me genetic sequences that just happen to look a certain way, as you indicate.

Here is a great source for millions of sequences for you to use as examples:

Home - Gene - NCBI


Surely, you are familiar with this site?

In these cases (most idels fall into this category) it is just as likely these are just the normal parts of that creature’s genome. I have been through this before in another thread.

Nice assertion.
Yes, and I am sure that in that other thread you provided all kinds of evidence that supports your unorthodox take on the existence of things that are, you know, actually called insertions and deletions for a reason that apparently was overlooked by every other person researching genetics - perhaps you support it with a Blum quote, or the way you supported your 'SAME GENES' thing?

And I never referred to both patterns being in two humans...I said when we compare the genomes of two different creatures the program automatically creates these gaps (in order the “ALIGN” similar sequences) which is then interpreted as insertions or deletions (whichever is convenient).

I don't care what you wrote. If you think that when comparing two humans these things do not come up, then you have no idea what you are talking about.

I see indels when comparing two chimps or two macaques - as well as 2 humans.

In the creatures themselves these gaps DO NOT EXIST.

Thank you Dr.Gish.

OBVIOUSLY there are no 'gaps' in a genome.

Also, there are no petri dishes in nature, so surely you reject all information gleaned from things grown in petri dishes?


Here is how it works -

"Actually, for about 1/4 of your genome, you and your sibling are like identical twins, i.e. you have the same two parental copies of the DNA. Insertions and deletions (nicknamed indels) of up to about 100 bases are harder to enumerate but an order of magnitude of 1 million per genome is observed, about 3000 of them in coding regions (so an underrepresentation of about half an order of magnitude). Larger variations of longer stretches including copy number variations are in the tens of thousands per genome but because they are such long stretches their summed length might be longer than the number of bases in SNPs."

So, please explain to us how that was determined (yes, that particular source is using estimates, but it is based on published data). How is it that indels can be seen in human genomes when 'gaps aren't there' and nobody observed the insertions/deletion occur?


Below is the result of a pairwise comparison of 2 variants of the human KLF11 mRNA.

EMBOSS Water - Alignment

My goodness - a bunch of INDELS right there at the beginning!

7 of them!

Please explain how that can be!

Yes, the actual sequences are 'how they are' in the humans, but when comparing the sequences, those evil programs - designed to find similarity, according to you - insert GAPS where the sequences do not align.

By the way - most of the alignment programs I have used spit out %similarity scores just as an aside - it falls out of the actual comparisons.

Of course, if the program tells you 2 sequences are 94% identical, it also tells you - ready for this? - that they are 6% NOT identical.


Phylogeny programs are more interested in the 6% dissimilarity... if anything, they assume that the majority of the sequences will be identical.

The actual genome has these as differences and the program ignores these as contrary to its purpose of finding and establishing areas of similarity (that’s its purpose). Are you disputing that?

Yes, very much. I very much dispute your characterization of these software programs based on your need to dismiss their outcomes.

The programs do NOT ignore them!

Alignment programs are what FIND THEM (can also be done by eye - as alignments were actually done for many years).

The programs are not designed to 'find similarities' as you say (unless it is a program specifically told to do so), in fact, for the most part, they are 'designed' to find patterns of differences, wherein they insert gaps.

For how else to glean relevant information from a situation like this -

We have 2 sequences to compare:

1. ATCGGTCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT

2. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT


I use one of the biased, untrustworthy, anti-Jesus programs that you have declared exist solely to find similarities and ignore differences and I get:

1. ATCGGTCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
2. ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT

And I conclude that an indel exists at this locus. I cannot tell whether it is an insertion or a deletion at this point for I have no other reference (you need 3 or more sequences to determine polarity), but I conclude that it is an indel. This means that, in this locus, these two sequences are 93% similar (remember, this is just an alignment), with a 3-bp indel.

Goodness no! GAPS! Gaps do not exist in real life! This is all a scam!

Pshun2404 looks at the two sequences:

1. ATCGGTCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
2. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT

and concludes that this is just the way the Designer made them, and they are but 7% similar.


Let us use a non-DNA analogy to see which 'ideology' is more reasonable.

Say we have two lines of humans. One line has 100 dudes standing in line wearing red caps. The other has 100 dudes with the first 3 in line wearing black caps and the remaining 97 wearing red caps.

I say that the lines are 97% similar. Pshun2404 says they are 0% similar.


So, now we have the alignment. We can then test phylogenetic hypotheses (you need more than 2 sequences or taxa, so lets just consider that we do have more).


Depending on the program, indels are counted as either single mutational events or each bp difference is counted individually (not very realistic since an insertion or deletion is generally a 1 time event).

Say we have these 10 sequences:


1. ATCGGTCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
2. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
3. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
4. ATCCCCCGTCACACAAATTTGTCGTGTAAGTGTGTGT
5. ATCCCCCGTCACACAAATTTGTCGTGTAAGTGTGTGT
6. ATCCCCCGTCACACAAATTTGTCGTCCCGTAATTTGTGTGTGT
7. ATCCCCCGTCACACAAATTTGTCGTCCCGTAATTTGTGTGTGT
8. ATCCCCCGTCACACAAAGTCGTCCCGTAAGTGTGTGT
9. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGTTTT
10.ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGTTTT

WE RUN THEM THROUGH OUR EVIL, BIASED, ASSUMPTION-LADEN ALIGNMENT PROGRAM AND WE GET:

1. ATCGGTCCCCGTCACACAAATTTGTCGTCCCGTAA- - -GTGTGTGT- - -
2. ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAA- - -GTGTGTGT- - -
3. ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAA- - -GTGTGTGT- - -
4. ATC- - -CCCCGTCACACAAATTTGTCGT- - -GTAA- - -GTGTGTGT- - -
5. ATC- - -CCCCGTCACACAAATTTGTCGT- - -GTAA- - -GTGTGTGT- - -
6. ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAATTTGTGTGTGT- - -
7. ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAATTTGTGTGTGT- - -
8. ATC- - -CCCCGTCACACAAA- - -GTCGTCCCGTAA- --GTGTGTGT- - -
9. ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAA- - -GTGTGTGTTTT
10.ATC- - -CCCCGTCACACAAATTTGTCGTCCCGTAA- - -GTGTGTGTTTT


I can see some interesting patterns emerge - for example, I would conclude that sequence 1 experienced an insertion of GGT based on the fact that it is the only sequence to possess it (it could also be that sequences 9-10 share a common ancestor that lost that GGT, and there would be ways to tell, but I don't want to get too far into the weeds with this off-the-cuff made-up example).

Pshun would have us believe that all we can say is this:

1. ATCGGTCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
2. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
3. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGT
4. ATCCCCCGTCACACAAATTTGTCGTGTAAGTGTGTGT
5. ATCCCCCGTCACACAAATTTGTCGTGTAAGTGTGTGT
6. ATCCCCCGTCACACAAATTTGTCGTCCCGTAATTTGTGTGTGT
7. ATCCCCCGTCACACAAATTTGTCGTCCCGTAATTTGTGTGTGT
8. ATCCCCCGTCACACAAAGTCGTCCCGTAAGTGTGTGT
9. ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGTTTT
10.ATCCCCCGTCACACAAATTTGTCGTCCCGTAAGTGTGTGTTTT

Created as-is. Nothing to see here.


Too bad that the tested methods that I have referred to call such a conclusion nonsense.

 

[pshun2404]

I am busy right at the moment, but you (unknowingly) have actually proved my point. But here is a small sample example where there is only a one base pair difference:

Human segment: AGTCGTACCAGTCGTACC

Same segment in Chimp: AGTCATACCAGTCTACC

So via computer programs they separate the chimp genome after AGTC and then call the human G an “insertion”, or the lack thereof in the Chimp a “deletion”, but what if the two respective genomes are exactly what they are supposed to be and nothing was actually ever inserted or deleted? When the intelligently designed program is applied they create a non-existent gap...

Human: AGTCGTACCAGTCGTACC

Chimp: AGTCGTACCAGTC TACC

which now must be explained!

Now in reality that gap does not exist! But in reality they simply were always a normal part of each respective genome (just as they are, one in one order with their sequence, and the other in their order with a different sequence). Thus always what it is in each (making each creature what they are uniquely), there is absolutely no need to automatically assume one is inserted and/or the other is deleted.

Now because of the presupposition we have been indoctrinated to accept as truth (though unfounded and not demonstrated). The human programming CANNOT ACCEPT the data just as it is and so they must make up ‘once upon a time’ stories (Ernst Mayr calls them “historical narrative” I call this one "the ancestor of the gaps") to make the contrary data look as if it fits their preconceived hypothesis.

One has to ASSUME that at one time in the remote undemonstrable past the genomes were the same (i.e., Last Common Ancestor default).

But to confirm it true one must produce an example of the original model for comparison or else the whole assumption remains in the realm of the theoretical and hypothetical. You CAN see that makes perfectly logical sense can't you? If TRUE critical thinking is not allowed I anticipate more attack of my character, and intelligence.

Please note that if we just start here following the G unique to humans the two series of sequence no longer match...!

Now COULD THIS indicate an insertion? Could be, might be...
Could it also be possible it is not, but rather is just what it IS...the normal human genome as opposed to the normal chimp genome? Could be, might be...

Neither OPINION is a fact and should not be assumed so!

 

[pshun2404]

After reading your small book I will attempt to answer some of these many points and questions in small segments.

I said “In fact there are no GERMLINE mutations BETWEEN most types of apes, though some apes do have similar mutations with other apes, and even with some monkeys, and humans also share some of these similar mutations but they are not inherited from one another.”

Then YOU asked the following four questions:

“What is your EXPLANATION as to why we can assess mutational patterns within groups, but not outside of those groups?

Do you not accept that insertions or deletions can occur in the germline?

If not, why not? AND

At what point do these analyses become suspect, in your oh so educated and informed opinion?” (must get in at least one wise guy sarcastic pseudo-ad-hominem to give us your signature)

So first because the answer is the more obvious if you have bothered to actually read this thread for its content and reasoning, the “analyses” are not “suspect”, they are simply what they are...one way of interpreting the data (in this case, the presupposition already being accepted as true)...this is a form of confirmation bias.

Yes insertions and deletions CAN occur in a germline (say the human germline), and we can detect those because we have a normal original to compare it to. Of course mutations of the germline can be inherited according to the general principles, odds, and probabilities governing this process.

“What is your EXPLANATION as to why we can assess mutational patterns within groups, but not outside of those groups?

I have no idea where you get the idea I said that, or perhaps this is your assertion you can explain. We can assess mutational patterns within any group. But we cannot prove they are inherited across groups (as if one or few germlines continue for many millions of years in one animal into another) just shared in common between some groups for whatever reason it is essential or detrimental to that group.

Also I do not assume or explain why we can assess patterns because it is normal for humans to do so (apes certainly cannot). The key word being “assess” which means we interpret these patterns, but that does not necessitate our assessments are true OR that they are the only possible assessments (though they are the only ones someone holding the presupposition to be true will accept as possible).

 

[pshun2404]

when looking at germline mutations and inheritance, what, exactly, prevents these analyses from being used to compare different taxa?

Nothing, but that does not prove relationship in a lineal sense...comparisons show we are different creatures nothing more since all life has a genome and share many common characteristics.


“...the fact is mostly all alleged “insertions” have never actually been shown to have been inserted.”

That is a fact?

Yes it is! I just recently gave one example (the G in the human sequence not in the chimp sequence)...it can

a) be accepted for what it actually is (one of the many genomic differences in what is human versus what is chimp), OR

b) interpreted as an insertion into the human genome, OR

c) interpreted as a deletion in the chimp genome

All equally valid possibilities!

Are you saying that ALL the things considered to be indels in human genomes are not really indels?

That is correct.

Thus you negate your earlier statement - sure you understand insertions, but no, the things actual geneticists and the like see as insertions are not because they have not been shown to be?

No negation...I do understand what insertions and deletions are and how they must be demonstrated to be so (according to understanding of the rules of evidence) to CLAIM that is what they are. The claim just based on presence of difference is a hypothesis bases assumption.

For example, we know an HIV genomic insertion has taken place when because it was not there originally and now is, it is demonstrated to have been inserted.

The same rule applies in all fields (apparently not in yours so long as it agrees with the presupposition).

If you accept that insertions occur, how, EXACTLY does pshun2404 determine whether or not what we see in a DNA sequence is or is not the result of insertion/deletion?

It is not a matter of what pshun2404 determines, it is how one determines how anything is added to or taken away from any system.

When cosmologists claim a new star has been born that is because it was never seen in any hithertofore examinations of that part of that star system and now is. When it is claimed that something has been added or taken away from a contract, the person claiming this must be able to produce the original for comparison. In choosing a cloning vector, they must be small molecules because they are easier to manipulate. The sequence being inserted must be capable of prolific replication inside the recipient cell in order to enable the amplification of the inserted donor fragment. Identifying such an insertion is easily confirmed. It is confirmed because we can see how it was not there, and now is there (which we know because we did it but the point is it can actually be said to be an insertion)!

I have many more examples.

 

[pshun2404]

Show me genetic sequences that just happen to look a certain way, as you indicate.

Sure...

AAGAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC [Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC [Chimpanzee GULOP (Exon10)]

I have more examples...

The first is part of what equals human, the second what equals chimp!

I have to go now and will be back later....