Prove it or remove it challenge

[Loudmouth]

Yeah I understand.

It's pretty disappointing to get so easily and repeatedly schooled by someone you so thoroughly disrespect.

Get used to it.

That would require you to present evidence, which you haven't done.

 

[Loudmouth]

Theists come to a different conclusion than naturalists.

They have a faith based belief. Not the same thing.

Naturalists conclude that evolution is a purely natural process, as Darwin theorized.

That is false. Naturalists conclude that the evidence is consistent with natural mechanisms. They have never ruled out other processes.

Theists typically believe that either evolution is limited to adaptation, or that evolution is guided by an intelligent agent.

The majority of Christians across the globe accept that species evolved from a common ancestor through the mechanisms described by the theory of evolution. You might as well argue that theists reject gravity, and require a supernatural deity to guide planets around the Sun.

It's very exceedingly rare to find a theist who believes that God was completely uninvolved in evolution.

Why would God need to stop or change natural processes in order to be involved, natural processes that God supposedly created?

I would not agree with the statement that "most" Christians agree with evolution, but I don't think that was your point so it doesn't matter.

Reality does not need your agreement.

 

[Loudmouth]

We don't stop there. We propose that based on empirical evidence, DNA is a coded information bearing system of specified complexity (only one of several such systems in the human body), and additionally that there are no natural explanations for it. No fundamental forces that coordinate to generate the specified intelligent information.

First, you have never shown that natural processes can't produce specified complexity. Even more, you haven't even shown that it can be measured or detected. For example, does this sequence contain specified complexity?

CAATGTGCGGATGGCGCCACGACTTACTGGGCCTGATTTCACCGCTTCTAATACCGCACACTGGGCAATACGAGGTCAAGCCAGTCACGCAGTAACGTTCATCAGCTAACGTAACAGTTAGAGGCTCGCTAAATCGCACTGTCGGCGTCCCTTGGGTATTTTACGCTAGCATCAGGTAGGCTAGCATGTATCTTTCCTCC

Second, stating that ID must be true if there are no known natural explanations is a very obvious argument from ignorance. You have to prove your claims as much as anyone else. Do you see evolutionists claiming that evolution simply must be true because you don't have any evidenced explanations?

We propose that in our uniform and repeated experience, any example of coded information based on specified complexity has an intelligent source. No exceptions.

Until you define what coded information and specified complexity are, you really can't make that claim.

 

[Paterfamilia]

This is going to be a fun debate!

Thanks for your input ((you did a lot of work, (respect)) and it gave me some good ideas.

Two quick things, your code string may or may not have specified complexity. We don't know until we make an assignment of a causal relationship to an outcome. That's assuming that you were emulating DNA. Break the code, get the information. That's the challenge.

Takes me back to my years at NSA though ha ha.

We don't make the assertion that it "Must" be true. We simply say that there are zero known or demonstrated instances of specified complex coded information in our unifrom and repeated experience that don't have an intelligent cause.

That's it.

Your list is a queue of ugly strawmen ha ha.

 

[Loudmouth]

Two quick things, your code string may or may not have specified complexity. We don't know until we make an assignment of a causal relationship to an outcome. That's assuming that you were emulating DNA. Break the code, get the information. That's the challenge.

If you can't measure specified complexity, then how can you determine if it increases or decreases? If you can't determine if a mutation increases or decreases specified complexity, then how can you determine that evolution can not produce specified complexity?

We don't make the assertion that it "Must" be true. We simply say that there are zero known or demonstrated instances of specified complex coded information in our unifrom and repeated experience that don't have an intelligent cause.

You are assuming that DNA is from an intelligent cause. You are assuming your conclusion.

 

[Paterfamilia]

I think it is plain to see that you have tried to argue that Miller and Urey were trying to create life, not just biomolecules. Time to own up to this fact.

Bull again. Dang you don't mind slapping yourself around do you?

Strip everything else off. Just prove that one point. Show where I said that Miller-Urey were trying to create life, and I will own up to it.

And I won't ask you to in turn own up to your mistake.

 

[Loudmouth]

Bull again. Dang you don't mind slapping yourself around do you?

Strip everything else off. Just prove that one point. Show where I said that Miller-Urey were trying to create life, and I will own up to it.

And I won't ask you to in turn own up to your mistake.

I know what the experiments were for:

The Miller-Urey Experiment
The Miller-Urey experiment was an experiment that simulated hypothetical conditions present on the early Earth in order to test what kind of environment would be needed to allow life to begin. The experiment is considered to be the classic experiment on the origin of life. It was conducted in 1953 by Stanley L. Miller and Harold C. Urey at the University of Chicago.

http://www.juliantrubin.com/bigten/miller_urey_experiment.html (et al)
--Paterfamilia post 954​

 

[Paterfamilia]

If you can't measure specified complexity, then how can you determine if it increases or decreases? If you can't determine if a mutation increases or decreases specified complexity, then how can you determine that evolution can not produce specified complexity?



You are assuming that DNA is from an intelligent cause. You are assuming your conclusion.

I don't think you can conflate faith with assumptions. You would have to prove that. By that I mean that faith and assumptions are two different things. Maybe you could make a case that some of my assumptions are based on faith, but aren't in themselves tenets of faith. Is that what you are saying?

Anyway, with regard to ID, we make the case that the empirical evidence demonstrates that DNA comprises coded information. The discreet morphological characteristics of any living organism is manifest proof of that. Each has its own body plan, it's own taxonomy, it's own appearance, all as a result of its own DNA.

Did you see my "100 dice" analogy/demonstration? It was quite a few pages back.

My faith is largely independent of our physical realities. It is based on a completely different epistemology set.

 

[Paterfamilia]

I know what the experiments were for:

The Miller-Urey Experiment
The Miller-Urey experiment was an experiment that simulated hypothetical conditions present on the early Earth in order to test what kind of environment would be needed to allow life to begin. The experiment is considered to be the classic experiment on the origin of life. It was conducted in 1953 by Stanley L. Miller and Harold C. Urey at the University of Chicago.

http://www.juliantrubin.com/bigten/miller_urey_experiment.html (et al)
--Paterfamilia post 954​

Okay. But you said that my claim was that they were trying to create life. That's a very different thing. Don't you see the difference?

 

[Loudmouth]

I don't think you can conflate faith with assumptions. You would have to prove that. By that I mean that faith and assumptions are two different things. Maybe you could make a case that some of my assumptions are based on faith, but aren't in themselves tenets of faith. Is that what you are saying?

You assume that life had to come about due to an intelligence so that you can conclude that DNA was produced by an intelligence. It is a circular argument.

Anyway, with regard to ID, we make the case that the empirical evidence demonstrates that DNA comprises coded information. The discreet morphological characteristics of any living organism is manifest proof of that. Each has its own body plan, it's own taxonomy, it's own appearance, all as a result of its own DNA.

Where is the evidence that this coded information was produced by an intelligence?

Did you see my "100 dice" analogy/demonstration? It was quite a few pages back.

If you are referring to post 840, it has very little to do with biology or DNA. I gave you a string of bases, and you couldn't determine if it was produced by an intelligence or not, or even if they are specific or not.

DNA bases don't spell out phone numbers.

My faith is largely independent of our physical realities. It is based on a completely different epistemology set.

That is something that I have often seen. Religious beliefs are often excluded from the scrutiny we use for other claims.

 

[Paterfamilia]

If you can't measure specified complexity, then how can you determine if it increases or decreases? If you can't determine if a mutation increases or decreases specified complexity, then how can you determine that evolution can not produce specified complexity?

Of course we can measure specified complexity. In many cases we know exactly which segments of DNA code for which proteins that get made, etc.

Do a google search on molecular machines and watch some of the videos. Mind-blowing. Seriously.

 

[Loudmouth]

Okay. But you said that my claim was that they were trying to create life. That's a very different thing. Don't you see the difference?

Then why did you use a reference where it states that they were trying to create life?

 

[Loudmouth]

Of course we can measure specified complexity.

Then measure the specified complexity of this DNA sequence.

AGTCTCCAATTTCTTGTTTCCGAATGACACGCGTCTCCTTGCGGGTAAATCGCCGACCGCAGAACTTAGGAGCCAGGGGGAACAGATAGGTCTAATTAGGTTAAGGGAGTAAGTCCTCGGATGGTTCAGTTGTAACCATATACTTACGCTGGAACTTCTCCGGCGAATTTTTACTGTCACCAACCACGAGATTTGAGGTAAACCAATTGAGCACATAGTCGCGCTATCCGACAATCTCCAAATTATAACATACCGTTCCATGAAGGCCAGAGTTACTTACCGGCCCTTTCCATGCGCGCG

In many cases we know exactly which segments of DNA code for which proteins that get made, etc.

We also know which atoms code for which molecules. For example:

2H2 + O2 ----> 2H2O

By your definition, water contains coded information.

Do a google search on molecular machines and watch some of the videos. Mind-blowing. Seriously.

Where is the evidence that they are intelligently designed?

 

[Paterfamilia]

You assume that life had to come about due to an intelligence so that you can conclude that DNA was produced by an intelligence. It is a circular argument.



Where is the evidence that this coded information was produced by an intelligence?



If you are referring to post 840, it has very little to do with biology or DNA. I gave you a string of bases, and you couldn't determine if it was produced by an intelligence or not, or even if they are specific or not.

DNA bases don't spell out phone numbers.



That is something that I have often seen. Religious beliefs are often excluded from the scrutiny we use for other claims.

I appreciate you sticking to your arguments. However, we are kind of going around in circles. ID is based only on empirical evidence. It doesn't conclude who the causal agent is. Coulda been aliens or some othe intelligence that we don't know anything about.

What we do know is that information, in our experience without exception comes from intelligent agency. Please give any counterfactual if you can.

My example was intended to show what specified complexity is. I wasn't claiming that it was DNA.

Your code string is meaningless to me. If there is any intelligence in it, it would have to be decoded and translated into a language that I understand. If there is any information coded into it, it would have to be decoded by the intelligent agent who embedded the information in the first place.

Religious beliefs are usually excluded from empirical study by necessity. The naturalist (naturally) objects.

Religious beliefs are held by faith. Faith is not measurable by science, but then neither is love. Both are just as real as the nose on your face.

 

[Paterfamilia]

Then why did you use a reference where it states that they were trying to create life?

IT DOESNT SAY THAT!!!!

Does anybody else agree with Loudmouth on this point? Does that reference claim that the Miller-Urey experiments were an attempt to create life?

 

[Loudmouth]

I appreciate you sticking to your arguments. However, we are kind of going around in circles. ID is based only on empirical evidence. It doesn't conclude who the causal agent is. Coulda been aliens or some othe intelligence that we don't know anything about.

ID is based on the bare assertion that DNA had to be produced by an intelligence.

What we do know is that information, in our experience without exception comes from intelligent agency. Please give any counterfactual if you can.

What you need to present is evidence that DNA was produced by an intelligence.

Your code string is meaningless to me. If there is any intelligence in it, it would have to be decoded and translated into a language that I understand. If there is any information coded into it, it would have to be decoded by the intelligent agent who embedded the information in the first place.

Now you can't even detect specified complexity in DNA. I think that rests my case.

Religious beliefs are usually excluded from empirical study by necessity. The naturalist (naturally) objects.

Religious beliefs are held by faith. Faith is not measurable by science, but then neither is love. Both are just as real as the nose on your face.

Love is measureable. All emotions can be measured by the release or neurotransmitters and fMRI. They have real effects in the real world.

Religious beliefs are indistinguishable from belief in something that is non-existent. If religious beliefs were held to the same rigors that we hold other claims to, then those religious beliefs would be thrown out. However, due to the emotional attachment that theists have for these beliefs, they are excluded from scrutiny.

 

[Hammster]

MOD HAT ON


Moved from Physical & Life Sciences.


MOD HAT OFF

 

[Loudmouth]

IT DOESNT SAY THAT!!!!

Yes, it does. I am not the only one who read it that way. Subduction zone also responded the same as I did.

 

[Loudmouth]

Historically, abiogenesis was certainly lumped in with naturalistic evolution. Remember the primordial soup and lightning and Miller-Urey etc.?

The current science of the time supposed that life in a microscope was so simple, it could have easily happened given the right conditions.

Remember this post? It certainly indicates that you thought the M-U experiment was trying to create life.

 

[lasthero]

IT DOESNT SAY THAT!!!!

Does anybody else agree with Loudmouth on this point? Does that reference claim that the Miller-Urey experiments were an attempt to create life?

I agree with loudmouth.