• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

Prove it or remove it challenge

Status
Not open for further replies.

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Theists come to a different conclusion than naturalists.

They have a faith based belief. Not the same thing.

Naturalists conclude that evolution is a purely natural process, as Darwin theorized.

That is false. Naturalists conclude that the evidence is consistent with natural mechanisms. They have never ruled out other processes.

Theists typically believe that either evolution is limited to adaptation, or that evolution is guided by an intelligent agent.

The majority of Christians across the globe accept that species evolved from a common ancestor through the mechanisms described by the theory of evolution. You might as well argue that theists reject gravity, and require a supernatural deity to guide planets around the Sun.

It's very exceedingly rare to find a theist who believes that God was completely uninvolved in evolution.

Why would God need to stop or change natural processes in order to be involved, natural processes that God supposedly created?

I would not agree with the statement that "most" Christians agree with evolution, but I don't think that was your point so it doesn't matter.

Reality does not need your agreement.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
We don't stop there. We propose that based on empirical evidence, DNA is a coded information bearing system of specified complexity (only one of several such systems in the human body), and additionally that there are no natural explanations for it. No fundamental forces that coordinate to generate the specified intelligent information.

First, you have never shown that natural processes can't produce specified complexity. Even more, you haven't even shown that it can be measured or detected. For example, does this sequence contain specified complexity?

CAATGTGCGGATGGCGCCACGACTTACTGGGCCTGATTTCACCGCTTCTAATACCGCACACTGGGCAATACGAGGTCAAGCCAGTCACGCAGTAACGTTCATCAGCTAACGTAACAGTTAGAGGCTCGCTAAATCGCACTGTCGGCGTCCCTTGGGTATTTTACGCTAGCATCAGGTAGGCTAGCATGTATCTTTCCTCC

Second, stating that ID must be true if there are no known natural explanations is a very obvious argument from ignorance. You have to prove your claims as much as anyone else. Do you see evolutionists claiming that evolution simply must be true because you don't have any evidenced explanations?

We propose that in our uniform and repeated experience, any example of coded information based on specified complexity has an intelligent source. No exceptions.

Until you define what coded information and specified complexity are, you really can't make that claim.
 
  • Like
Reactions: DogmaHunter
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
This is going to be a fun debate!

Thanks for your input ((you did a lot of work, (respect)) and it gave me some good ideas.

Two quick things, your code string may or may not have specified complexity. We don't know until we make an assignment of a causal relationship to an outcome. That's assuming that you were emulating DNA. Break the code, get the information. That's the challenge.

Takes me back to my years at NSA though ha ha.

We don't make the assertion that it "Must" be true. We simply say that there are zero known or demonstrated instances of specified complex coded information in our unifrom and repeated experience that don't have an intelligent cause.

That's it.

Your list is a queue of ugly strawmen ha ha.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Two quick things, your code string may or may not have specified complexity. We don't know until we make an assignment of a causal relationship to an outcome. That's assuming that you were emulating DNA. Break the code, get the information. That's the challenge.

If you can't measure specified complexity, then how can you determine if it increases or decreases? If you can't determine if a mutation increases or decreases specified complexity, then how can you determine that evolution can not produce specified complexity?

We don't make the assertion that it "Must" be true. We simply say that there are zero known or demonstrated instances of specified complex coded information in our unifrom and repeated experience that don't have an intelligent cause.

You are assuming that DNA is from an intelligent cause. You are assuming your conclusion.
 
  • Like
Reactions: DogmaHunter
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
I think it is plain to see that you have tried to argue that Miller and Urey were trying to create life, not just biomolecules. Time to own up to this fact.

Bull again. Dang you don't mind slapping yourself around do you?

Strip everything else off. Just prove that one point. Show where I said that Miller-Urey were trying to create life, and I will own up to it.

And I won't ask you to in turn own up to your mistake.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Bull again. Dang you don't mind slapping yourself around do you?

Strip everything else off. Just prove that one point. Show where I said that Miller-Urey were trying to create life, and I will own up to it.

And I won't ask you to in turn own up to your mistake.
I know what the experiments were for:

The Miller-Urey Experiment
The Miller-Urey experiment was an experiment that simulated hypothetical conditions present on the early Earth in order to test what kind of environment would be needed to allow life to begin. The experiment is considered to be the classic experiment on the origin of life. It was conducted in 1953 by Stanley L. Miller and Harold C. Urey at the University of Chicago.

http://www.juliantrubin.com/bigten/miller_urey_experiment.html (et al)
--Paterfamilia post 954​
 
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
If you can't measure specified complexity, then how can you determine if it increases or decreases? If you can't determine if a mutation increases or decreases specified complexity, then how can you determine that evolution can not produce specified complexity?



You are assuming that DNA is from an intelligent cause. You are assuming your conclusion.

I don't think you can conflate faith with assumptions. You would have to prove that. By that I mean that faith and assumptions are two different things. Maybe you could make a case that some of my assumptions are based on faith, but aren't in themselves tenets of faith. Is that what you are saying?

Anyway, with regard to ID, we make the case that the empirical evidence demonstrates that DNA comprises coded information. The discreet morphological characteristics of any living organism is manifest proof of that. Each has its own body plan, it's own taxonomy, it's own appearance, all as a result of its own DNA.

Did you see my "100 dice" analogy/demonstration? It was quite a few pages back.

My faith is largely independent of our physical realities. It is based on a completely different epistemology set.
 
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
I know what the experiments were for:

The Miller-Urey Experiment
The Miller-Urey experiment was an experiment that simulated hypothetical conditions present on the early Earth in order to test what kind of environment would be needed to allow life to begin. The experiment is considered to be the classic experiment on the origin of life. It was conducted in 1953 by Stanley L. Miller and Harold C. Urey at the University of Chicago.

http://www.juliantrubin.com/bigten/miller_urey_experiment.html (et al)
--Paterfamilia post 954​


Okay. But you said that my claim was that they were trying to create life. That's a very different thing. Don't you see the difference?
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
I don't think you can conflate faith with assumptions. You would have to prove that. By that I mean that faith and assumptions are two different things. Maybe you could make a case that some of my assumptions are based on faith, but aren't in themselves tenets of faith. Is that what you are saying?

You assume that life had to come about due to an intelligence so that you can conclude that DNA was produced by an intelligence. It is a circular argument.

Anyway, with regard to ID, we make the case that the empirical evidence demonstrates that DNA comprises coded information. The discreet morphological characteristics of any living organism is manifest proof of that. Each has its own body plan, it's own taxonomy, it's own appearance, all as a result of its own DNA.

Where is the evidence that this coded information was produced by an intelligence?

Did you see my "100 dice" analogy/demonstration? It was quite a few pages back.

If you are referring to post 840, it has very little to do with biology or DNA. I gave you a string of bases, and you couldn't determine if it was produced by an intelligence or not, or even if they are specific or not.

DNA bases don't spell out phone numbers.

My faith is largely independent of our physical realities. It is based on a completely different epistemology set.

That is something that I have often seen. Religious beliefs are often excluded from the scrutiny we use for other claims.
 
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
If you can't measure specified complexity, then how can you determine if it increases or decreases? If you can't determine if a mutation increases or decreases specified complexity, then how can you determine that evolution can not produce specified complexity?


Of course we can measure specified complexity. In many cases we know exactly which segments of DNA code for which proteins that get made, etc.

Do a google search on molecular machines and watch some of the videos. Mind-blowing. Seriously.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Of course we can measure specified complexity.

Then measure the specified complexity of this DNA sequence.

AGTCTCCAATTTCTTGTTTCCGAATGACACGCGTCTCCTTGCGGGTAAATCGCCGACCGCAGAACTTAGGAGCCAGGGGGAACAGATAGGTCTAATTAGGTTAAGGGAGTAAGTCCTCGGATGGTTCAGTTGTAACCATATACTTACGCTGGAACTTCTCCGGCGAATTTTTACTGTCACCAACCACGAGATTTGAGGTAAACCAATTGAGCACATAGTCGCGCTATCCGACAATCTCCAAATTATAACATACCGTTCCATGAAGGCCAGAGTTACTTACCGGCCCTTTCCATGCGCGCG

In many cases we know exactly which segments of DNA code for which proteins that get made, etc.

We also know which atoms code for which molecules. For example:

2H2 + O2 ----> 2H2O

By your definition, water contains coded information.

Do a google search on molecular machines and watch some of the videos. Mind-blowing. Seriously.

Where is the evidence that they are intelligently designed?
 
  • Like
Reactions: DogmaHunter
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
You assume that life had to come about due to an intelligence so that you can conclude that DNA was produced by an intelligence. It is a circular argument.



Where is the evidence that this coded information was produced by an intelligence?



If you are referring to post 840, it has very little to do with biology or DNA. I gave you a string of bases, and you couldn't determine if it was produced by an intelligence or not, or even if they are specific or not.

DNA bases don't spell out phone numbers.



That is something that I have often seen. Religious beliefs are often excluded from the scrutiny we use for other claims.


I appreciate you sticking to your arguments. However, we are kind of going around in circles. ID is based only on empirical evidence. It doesn't conclude who the causal agent is. Coulda been aliens or some othe intelligence that we don't know anything about.

What we do know is that information, in our experience without exception comes from intelligent agency. Please give any counterfactual if you can.

My example was intended to show what specified complexity is. I wasn't claiming that it was DNA.

Your code string is meaningless to me. If there is any intelligence in it, it would have to be decoded and translated into a language that I understand. If there is any information coded into it, it would have to be decoded by the intelligent agent who embedded the information in the first place.

Religious beliefs are usually excluded from empirical study by necessity. The naturalist (naturally) objects.

Religious beliefs are held by faith. Faith is not measurable by science, but then neither is love. Both are just as real as the nose on your face.
 
Upvote 0

Paterfamilia

Active Member
Site Supporter
Feb 18, 2016
292
22
67
Illinois
✟72,221.00
Gender
Male
Faith
Christian
Marital Status
Engaged
Then why did you use a reference where it states that they were trying to create life?



IT DOESNT SAY THAT!!!!

Does anybody else agree with Loudmouth on this point? Does that reference claim that the Miller-Urey experiments were an attempt to create life?
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
I appreciate you sticking to your arguments. However, we are kind of going around in circles. ID is based only on empirical evidence. It doesn't conclude who the causal agent is. Coulda been aliens or some othe intelligence that we don't know anything about.

ID is based on the bare assertion that DNA had to be produced by an intelligence.

What we do know is that information, in our experience without exception comes from intelligent agency. Please give any counterfactual if you can.

What you need to present is evidence that DNA was produced by an intelligence.

Your code string is meaningless to me. If there is any intelligence in it, it would have to be decoded and translated into a language that I understand. If there is any information coded into it, it would have to be decoded by the intelligent agent who embedded the information in the first place.

Now you can't even detect specified complexity in DNA. I think that rests my case.

Religious beliefs are usually excluded from empirical study by necessity. The naturalist (naturally) objects.

Religious beliefs are held by faith. Faith is not measurable by science, but then neither is love. Both are just as real as the nose on your face.

Love is measureable. All emotions can be measured by the release or neurotransmitters and fMRI. They have real effects in the real world.

Religious beliefs are indistinguishable from belief in something that is non-existent. If religious beliefs were held to the same rigors that we hold other claims to, then those religious beliefs would be thrown out. However, due to the emotional attachment that theists have for these beliefs, they are excluded from scrutiny.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Historically, abiogenesis was certainly lumped in with naturalistic evolution. Remember the primordial soup and lightning and Miller-Urey etc.?

The current science of the time supposed that life in a microscope was so simple, it could have easily happened given the right conditions.

Remember this post? It certainly indicates that you thought the M-U experiment was trying to create life.
 
Last edited:
  • Like
Reactions: bhsmte
Upvote 0
Status
Not open for further replies.