Intelligent Design / Evolution

[Blayz]

ID does not propose anything

Fixed that for ya.

 

[TeddyReceptus]

Ever wonder why so many peer reviewed papers get published that are simply describing possible avenues of evolution? Why are there so few, if any, that actually detail how evolution HAS worked.

This is an interesting point. However I might point out that the publication of concepts about how evolution works start from the known facts:

1. Life has changed over time
2. There are mechanisms by which populations can and do adapt and change (naturally, with no outside forces...unless the "intelligent designer" stepped in repeatedly throughout geologic history to "re-design" things subtley)

We have evidence of life changing over geologic time. It appears to be changing and adapting from hundrends of millions of years ago up until the present. New species show up throughout the geologic record.

So if one wishes to go with an "intelligent designer" then that designer must have stepped in (invisibly) to alter life throughout earth's history.

IF one limits ID to only creation of the cosmos then one is dabbling in the "ultimate origins" question. This is the purview of philosophy. What happened before time?

This is another problem for "Intelligent Design" theorists. What is ID limited to?

Clearly it cannot be an explicator for the wide variety of life we see over the past 600 million years (or even going back a couple billion to the first stromatolites and other bacteria and phytoplankton) because then that intelligent designer must have been busy throughout the history of earth. Is it a race of invisible beings?

Or does ID really only have interest in what started the universe?

If it is the latter, the "Designer of physical laws" then there is little reason to treat it as particularly robust science. It joins the ranks of cosmology hypothetical from before the beginning of all things.

So go ahead and throw out any number of questions about "how did [feature X] arise?" There are numerous quite natural, non-ID, non-theological, non-religious, non-supernatural methods.

I would love it if the ID movement would allow one of their own to say "I have discovered the Intelligent Designer. His names was Xyklor M. Yppus and he lived on Neptune in a small log cabin made of hyperwood. He designed life on earth using a program developed by Neptunian computer scientists called 'Glorpware' and I am going to work on finding evidence of this being! I will start with a manned mission to NEPTUNE!"

See, this would be interesting, but I think we all know that the minute the ID propentist suggested this he would be disavowed by the other ID scientists. (And likely shunned by his fellow congregation members at church...oh, yeah, isn't ID all about 'God'? Well, clearly not! Because that would be Creationism...and you can't get that in schools since its religion.)

Yup, ID right now is busy trying to figure out a way to show us what a "design" is and what isn't designed.

Can you tell me if this looks "designed" to you?

Interestingly enough do you know who the "designer" of this is?

It's this guy:

Yes, Admiral Amana makes these things every day! He uses his amazing skills with Paulings Rules which dictate how atoms coordinate in solids, and he also makes use of the magic of "hydrogen bonding".

And he creates them, even when no one is around to watch him do it!

 

[Zaius137]

This is an interesting point. However I might point out that the publication of concepts about how evolution works start from the known facts:

1. Life has changed over time
2. There are mechanisms by which populations can and do adapt and change (naturally, with no outside forces...unless the "intelligent designer" stepped in repeatedly throughout geologic history to "re-design" things subtley)

We have evidence of life changing over geologic time. It appears to be changing and adapting from hundrends of millions of years ago up until the present. New species show up throughout the geologic record.

So if one wishes to go with an "intelligent designer" then that designer must have stepped in (invisibly) to alter life throughout earth's history.

IF one limits ID to only creation of the cosmos then one is dabbling in the "ultimate origins" question. This is the purview of philosophy. What happened before time?

This is another problem for "Intelligent Design" theorists. What is ID limited to?

Clearly it cannot be an explicator for the wide variety of life we see over the past 600 million years (or even going back a couple billion to the first stromatolites and other bacteria and phytoplankton) because then that intelligent designer must have been busy throughout the history of earth. Is it a race of invisible beings?

Or does ID really only have interest in what started the universe?

If it is the latter, the "Designer of physical laws" then there is little reason to treat it as particularly robust science. It joins the ranks of cosmology hypothetical from before the beginning of all things.

So go ahead and throw out any number of questions about "how did [feature X] arise?" There are numerous quite natural, non-ID, non-theological, non-religious, non-supernatural methods.

I would love it if the ID movement would allow one of their own to say "I have discovered the Intelligent Designer. His names was Xyklor M. Yppus and he lived on Neptune in a small log cabin made of hyperwood. He designed life on earth using a program developed by Neptunian computer scientists called 'Glorpware' and I am going to work on finding evidence of this being! I will start with a manned mission to NEPTUNE!"

See, this would be interesting, but I think we all know that the minute the ID propentist suggested this he would be disavowed by the other ID scientists. (And likely shunned by his fellow congregation members at church...oh, yeah, isn't ID all about 'God'? Well, clearly not! Because that would be Creationism...and you can't get that in schools since its religion.)

Yup, ID right now is busy trying to figure out a way to show us what a "design" is and what isn't designed.

Can you tell me if this looks "designed" to you?

Interestingly enough do you know who the "designer" of this is?

It's this guy:

Yes, Admiral Amana makes these things every day! He uses his amazing skills with Paulings Rules which dictate how atoms coordinate in solids, and he also makes use of the magic of "hydrogen bonding".

And he creates them, even when no one is around to watch him do it!

In addition, Admiral Amana just self-assembled from natural chemistry…

An archeologist discovers arrowheads and surmises they did not come about by any natural occurrences such erosion or some spontaneous volcanism but in fact were the product of human (intelligent) activity. Does this archeologist have to explain whom these humans were before coming to the conclusion that intelligent agents created these arrowheads?

Id recognizes the obvious signs of a intelligent agent.

 

[idscience]

Can you tell me if this looks "designed" to you?


Interestingly enough do you know who the "designer" of this is?

It's this guy:

Yes, Admiral Amana makes these things every day! He uses his amazing skills with Paulings Rules which dictate how atoms coordinate in solids, and he also makes use of the magic of "hydrogen bonding".

And he creates them, even when no one is around to watch him do it!

ID differentiates between patterns and design. ID is trying to establish distinctions between the two. Dembski has done a lot of work on this. His work has not as yet been well received generally but many see the viability of specified complexity. Ice cubes and snowflakes need no outside influence to form. Chemistry and physical elements enable them to self assemble.

A honeycomb on the other hand has to be made by bees. The honeycomb is a pattern that depends on information outside itself. Living systems don't self assemble as it were. They need the information from the genome. They are built from a plan, regulated and maintained by mechanisms packed with the information to accomplish the task.

 

[USincognito]

An archeologist discovers arrowheads and surmises they did not come about by any natural occurrences such erosion or some spontaneous volcanism but in fact were the product of human (intelligent) activity. Does this archeologist have to explain whom these humans were before coming to the conclusion that intelligent agents created these arrowheads?

Arrowheads existed long before archeology and the process by which they come into being (hint, they're manufactured, they don't self-replicate) was similarly known long before the advent of that field of study. For that reason your analogy fails.

 

[idscience]

Arrowheads existed long before archeology and the process by which they come into being (hint, they're manufactured, they don't self-replicate) was similarly known long before the advent of that field of study. For that reason your analogy fails.

So your saying they are recognized. Similarily, DNA was recognized by Crick as being designed but told everyone to ignore that. Dawkins recognizes "apparent design" and ignores that as well. I guess, someone could pick up an arrowhead and just tell everyone it was not designed to penetrate flesh.

After they were design, came manufacture. Kinda like an eukaryote cell possibly.

If Z's analogy is flawed, so is yours.

 

[USincognito]

{snip}If Z's analogy is flawed, so is yours.

What analogy? I'm merely stating a fact. Arrowheads have been around a lot longer than archeology has. Same with pottery, beads, stone bone and wood tools, fire pits, worked leather, etc. etc. etc. There's no question about how they were and are manufactured.

They're not analagous to DNA or lifeforms at all.

 

[RickG]

Your are incorrect Rick. Id is increasing its footprint in the journals. Remember it is a relatively new hypothesis.

Oh come on, you have got to know better than that. There are no papers published in the relevant scientific journals, only those published in ID literature.

I agree, testing for design is a new idea as well but just becuase it has not been nailed down yet doesn't mean it is not valid. There are over 50 peer reviewed papers relating to intelligent design.

Peer reviewed only by ID proponents in ID journals, not scientific journals. ID uses scientific terms but does not follow the scientific method. It can't, there is nothing to test.

Evolution papers make all sorts of claims that show no real evidence just inference. Journals are full of them.

It is easy to make baseless statements such as that. You are incorrect. Papers on evolution have observed physical evidence and have made predictions that have been found to be true.

It has also been established that those who dare publish ID friendly papers are diciplined. ID is taboo for Evo scientists and you dare not mention it or else. That has nothing to do with the science.

It is not taboo, it is just untestable. If there were something to test scientists would be testing it.

Give an example of an hypothesis concerning ID that can be tested using the scientific method. No links or C&P, just state an hypothesis and let's see if it can be tested.

 

[chuck77]

Give an example of an hypothesis concerning ID that can be tested using the scientific method. No links or C&P, just state an hypothesis and let's see if it can be tested.

[FONT=TimesNewRoman,Bold][FONT=TimesNewRoman,Bold]1 The Definition of Irreducible Complexity[/FONT][/FONT]

Highly intricate molecular machines play an integral part in the life of
the cell and are increasingly attracting the attention of the biological
community. For instance, in February 1998 the premier biology journal​

[FONT=TimesNewRoman,Italic]Cell devoted a special issue to “macromolecular machines.” All cells use
complex molecular machines to process information, convert energy,
metabolize nutrients, build proteins, and transport materials across
membranes. Bruce Alberts, president of the National Academy of
Sciences, introduced this issue with an article titled “The Cell as a
Collection of Protein Machines.” In it he remarked,
We have always underestimated cells.... The entire cell can be
viewed as a factory that contains an elaborate network of
interlocking assembly lines, each of which is composed of a set of

large protein machines.... Why do we call the large protein

assemblies that underlie cell function protein [FONT=TimesNewRoman,Italic]machines[/FONT]? Precisely
because, like machines invented by humans to deal efficiently with
the macroscopic world, these protein assemblies contain highly​

coordinated moving parts.1

http://www.designinference.com/documents/2004.01.Irred_Compl_Revisited.pdf​

Can you do the same RickG? Can you give us an example of macro-evolution that is testable?

The kind of evolution that the ToE says happens?

[/FONT]

 

[DaneaFL]

I see you ID guys trying to make life analogous to things that are manufactured...

This is wrong because while it is true that things like cars, TVs, and arrowheads don't just spontaneously form in nature, it's because they can't self-replicate.

...and when you say that, likewise, humans, cats, and rabbits don't just spontaneously pop out of rocks,that's also true. But DNA which is controlled by just 4 basic natural chemistry DOES form spontaneously and they're shown it!

DNA is not a "language" or "code" that had to be intelligently deciphered... It's just the physical reaction of 4 natural chemicals that got more and more complex over time as it replicated itself... So at first look, DNA might appear "designed" but when you break it down to its basic parts you see how simple it actually is.

Not everything that is extremely complex MUST have had a designer... I think we can agree on that... just look at fractals.

 

[RickG]

[FONT=TimesNewRoman,Bold][FONT=TimesNewRoman,Bold]1 The Definition of Irreducible Complexity[/FONT][/FONT]

Highly intricate molecular machines play an integral part in the life of
the cell and are increasingly attracting the attention of the biological
community. For instance, in February 1998 the premier biology journal​

[FONT=TimesNewRoman,Italic]Cell devoted a special issue to “macromolecular machines.” All cells use
complex molecular machines to process information, convert energy,
metabolize nutrients, build proteins, and transport materials across
membranes. Bruce Alberts, president of the National Academy of
Sciences, introduced this issue with an article titled “The Cell as a
Collection of Protein Machines.” In it he remarked,
We have always underestimated cells.... The entire cell can be
viewed as a factory that contains an elaborate network of
interlocking assembly lines, each of which is composed of a set of

large protein machines.... Why do we call the large protein

assemblies that underlie cell function protein [FONT=TimesNewRoman,Italic]machines[/FONT]? Precisely
because, like machines invented by humans to deal efficiently with
the macroscopic world, these protein assemblies contain highly​

coordinated moving parts.1

http://www.designinference.com/documents/2004.01.Irred_Compl_Revisited.pdf​

Can you do the same RickG? Can you give us an example of macro-evolution that is testable?

The kind of evolution that the ToE says happens?

[/FONT]

Yet, none of any of those published in scientific journals say anything about an intelligent designer. Design? Yes! Atoms and molecules do form in specific designs which is due to the properties they exhibit. I am not arguing against ID, just that it does not do science. It is untestable. Stating irreducible complexity or design can only be the work of an intelligent designer is not a scientific approach. Yes, there is lots of complex design and extraordinary symmetry in nature. Saying only an intelligent designer could do this is not testable.

ID is a belief, not a science.

Examples of evolution? Explain the increased complexity and diversification of life throughout the geologic fossil record with out evolution. Why are there no rabbits in the Cambrian or Dinosaurs today? Why is it with each documented mass extinction that new and more diversified life is seen shortly afterwards (geologically speaking)?

 

[DaneaFL]

So your saying they are recognized. Similarily, DNA was recognized by Crick as being designed but told everyone to ignore that. Dawkins recognizes "apparent design" and ignores that as well. I guess, someone could pick up an arrowhead and just tell everyone it was not designed to penetrate flesh.

After they were design, came manufacture. Kinda like an eukaryote cell possibly.

If Z's analogy is flawed, so is yours.

Do you think God comes down to earth each day and personally carves each snowflake too? They have "apparent" design as well.

What about fractals in a computer? You punch a few equations in and soon you'll get a super complex pattern that MUST have been hand-painted, right?

Don't believe those things? then why do you assume DNA was designed intelligently? You know it's not a language, right? Languages require an intelligent translator in order to work... DNA is happy to do it's thing without any interpretation because it's not a code... It's just an arrangement of chemical reactions.

 

[TeddyReceptus]

In addition, Admiral Amana just self-assembled from natural chemistry…

No, Admiral Amana was made by humans who took about a million years to even come close to understanding the necessary technology to make Admiral Amana.

Evolution. Evolution. Evolution.

An archeologist discovers arrowheads and surmises they did not come about by any natural occurrences such erosion or some spontaneous volcanism but in fact were the product of human (intelligent) activity.

Because we've seen humans make arrowheads. But more trenchantly you do realize that many of the earliest human tools are almost completely indifferentiable from randomly broken rocks, right?

Does this archeologist have to explain whom these humans were before coming to the conclusion that intelligent agents created these arrowheads?

But we aren't talking about arrowheads are we? We're talking about the universe. Or we're talking about biochemical reaction pathways.

The ice crystal I showed up there is amazingly regular in its structure, yet isn't created by an intelligent designer. It forms quite naturally.

Id recognizes the obvious signs of a intelligent agent.

What "obvious" signs are those? The crystallographic orientation of atoms in a regular solid? Or do you mean any of a million other chemical reactions, but the ones that ID scientists are interested in are "special" because the ID scientists say they're special?

 

[TeddyReceptus]

ID differentiates between patterns and design. ID is trying to establish distinctions between the two.

But for now they are focused on "patterns". Or they look at items in nature and unilaterally decree that these are "irreducibly complex" (even when they aren't...like the bacterial flagellum which bears many structures in common with other bacterial features from which it likely developed) and they say "ooooo, look at this! It's amazing! Only an intelligence could be behind this!"

I could say the same thing about the ice crystal I showed earlier. I could point to it and say: "a child must be around to stack blocks evenly and repeatably, must know the pattern to build it! Ergo a stack of molecules must require at least that much knowledge!" But that would be wrong. Since there are people in norther Canada who can walk outside and even without seeing anyone around they can find ice crystals.

Ice cubes and snowflakes need no outside influence to form. Chemistry and physical elements enable them to self assemble.

The same thing can be said of many, many, many biochemical reactions and structures.

The lipid bilayer that lies at the heart of a cell wall can form naturally. The stereoselectivity of biological compounds is a quite common natural and wholly inorganic feature in chemistry.

The fact that ID scientists have to wall off a small area and make a decree that it is "special" inidicates that there's something wonky about it. The need for a "specialness" is the hallmark that maybe it isn't special.

There's precious little difference between life and non-life. Chemically speaking there's almost none.

A honeycomb on the other hand has to be made by bees. The honeycomb is a pattern that depends on information outside itself.

You mean like this?

Nope, that's a graphene sheet. A layer of graphite, carbon atoms which naturally coordinate into hexagonal layers. No bees needed.

Or this?

No, that's a sheet of silica tetrahedra from a phyllosilicate. Maybe it requires very small bees.

Now the fact that bees make hexagonal shapes is an interesting conjecture. So are you saying the bees are the "designers"? That the perhaps the bees brought some "intelligence" to the table? That they worked through various other designs and found this one the most correct?

What about corals that form polygonal colonies?

Are the corals "designing"? If so they are doing a great job without any real "brain" (or means of "thinking") So is the "designer" needed to be "intelligent"?

Living systems don't self assemble as it were. They need the information from the genome.

All of this is fundamentally simply chemistry. Albeit rather complex chemistry but I can point you in the direction of may non-life chemical reactions that are very complex.

The chemistry of the living systems in many ways is just...chemistry. There's nothing that is particularly "amazing".

The lipid layers that make up cell walls are extensions of what happens when you put sufficient soap in water. Lipids are compounds with a hydrophilic head and a hydrophobic tail. With enough surfactant in water they will form little "Micelles" wholly spontaneously. Little pockets that keep the water out.

Cell walls in living creatures are double layers of that but somewhat more complex.

The stereoselectivity of biological systems is a perfectly common chemical feature in non-life as well! Some mineral surfaces will preferentially absorb certain molecular orientations and not others. Based on stereoisomers. Just like living things.

They are built from a plan, regulated and maintained by mechanisms packed with the information to accomplish the task.

Just like the ice crystal I showed. Only the "packed with information" part is explained for you in the Pauling Rules. And it's basically just the way atoms work together.

I'm all for finding some "designer" if one is needed to explain the systems...but right now the search for a designer is more a need of the investigators, not a need of the system, imho.

 

[idscience]

I see you ID guys trying to make life analogous to things that are manufactured...

This is wrong because while it is true that things like cars, TVs, and arrowheads don't just spontaneously form in nature, it's because they can't self-replicate.

...and when you say that, likewise, humans, cats, and rabbits don't just spontaneously pop out of rocks,that's also true. But DNA which is controlled by just 4 basic natural chemistry DOES form spontaneously and they're shown it!

DNA is not a "language" or "code" that had to be intelligently deciphered... It's just the physical reaction of 4 natural chemicals that got more and more complex over time as it replicated itself... So at first look, DNA might appear "designed" but when you break it down to its basic parts you see how simple it actually is.

Not everything that is extremely complex MUST have had a designer... I think we can agree on that... just look at fractals.

DNA forms spontaneously? You should share that with the rest of the scientific community because no one else knows that.

DNA is a language by every definition of a language. The base pairs are arranged in a code.

Simple? hardley.

 

[Zaius137]

No, Admiral Amana was made by humans who took about a million years to even come close to understanding the necessary technology to make Admiral Amana.

Evolution. Evolution. Evolution.



Because we've seen humans make arrowheads. But more trenchantly you do realize that many of the earliest human tools are almost completely indifferentiable from randomly broken rocks, right?




But we aren't talking about arrowheads are we? We're talking about the universe. Or we're talking about biochemical reaction pathways.

The ice crystal I showed up there is amazingly regular in its structure, yet isn't created by an intelligent designer. It forms quite naturally.



What "obvious" signs are those? The crystallographic orientation of atoms in a regular solid? Or do you mean any of a million other chemical reactions, but the ones that ID scientists are interested in are "special" because the ID scientists say they're special?

It is amazing how two individuals can look at the same thing and draw completely different conclusions.

An Intelligent design perspective can hold the human head is a designed system to enclose an amazing machine that enables all human understanding.

Whereas an evolution view can say, the human head is a highly evolved hat rack.


Do you ever examine the other side of the evidence…. You can stay willfully ignorant or open your hat rack to opposing views.


Evolving the Irreducible - Behe's Mousetrap Problem

 

[Jonathan95]

Do you think God comes down to earth each day and personally carves each snowflake too? They have "apparent" design as well.

What about fractals in a computer? You punch a few equations in and soon you'll get a super complex pattern that MUST have been hand-painted, right?

Don't believe those things? then why do you assume DNA was designed intelligently? You know it's not a language, right? Languages require an intelligent translator in order to work... DNA is happy to do it's thing without any interpretation because it's not a code... It's just an arrangement of chemical reactions.

It's called DNA-code. A code has a creator. YHWH is written in our DNAs too.

 

[Jro]

It's called DNA-code. A code has a creator. YHWH is written in our DNAs too.

More like ACTTTTGCGCGCTAAACGTGTCCCCCAAATC

 

[Lion Hearted Man]

DNA forms spontaneously? You should share that with the rest of the scientific community because no one else knows that.

Nucleobases have been known for a long time to be able to form spontaneously under certain conditions. They're simply organic molecules.

DNA is a language by every definition of a language. The base pairs are arranged in a code.

Funny, you think that calling DNA a language means that it can't evolve. But the evolution of language is a beautiful analogy to the evolution of genetic material.

There is absolutely no reason to assume that genetic material was designed. Everything we know about genetics supports evolution.

 

[TeddyReceptus]

It is amazing how two individuals can look at the same thing and draw completely different conclusions.

An Intelligent design perspective can hold the human head is a designed system to enclose an amazing machine that enables all human understanding.

Whereas an evolution view can say, the human head is a highly evolved hat rack.

So you think that I am not impressed by the human brain? How did you arrive at that conclusion? Did you consult a hat rack?

Here's what I see when I look at a brain: I see an item that did not just "appear" on the scene. In fact I see about 3 billion years of life on earth with no brain whatsoever (bacteria, algae, plants, protists...), I see about 600 million years ago a few life forms show up in the rock record with simple neural networks followed a few million years later by simple "ganglion" (nerve bundles) and the later simple "brains". Fish have a rudiimentary brain nothing like ours but ours contains something similar to theirs. Bigger brains show up later in the rock record over the course of millions of years until finally only very recently has the higher primate brain showed up.

So if the human brain is a "designed" feature, why did the designer take about 3 billion years to "design" it?

Again, I come back to trying to understand this intelligent designer. Obviously it is a being that can either live several billion years but can't think particularly quickly or it is a race of beings who, despite 3 billion years of experimentation couldn't get around to a primate brain for that long.

BUT, I can very easily see that life changes over the millenia. And I can see structures that carry over into more advanced creatures.

This really looks a lot like "evolution".

Not so much "designed" (unless the designer was among the slowest witted beings to ever stumble through the cosmos...and that would kind of gut the whole idea of an "intelligent" designer).

Do you ever examine the other side of the evidence…. You can stay willfully ignorant or open your hat rack to opposing views.

I'm rather aware of the opposing views and I am also aware that many of the claims of irreducible complexity fail. Take the bacterial flagellum. It isn't irreducibly complex. In fact it shares many features of a simpler structure used by bacteria to penetrate cell walls.

They eye? Try staring with simple "photoreceptor cells" which harness light as a stimulus. They seem to be a great place to start on the route to the eye.

You may wish to assume I am "willfully ignorant" of the opposing view, but in reality it could be that I simply reject that opposing view based on what I do see around me.