I would like to debate the evidence for evolution!

[sfs]

This doesnt mean or is not evidence that one kind can completely change into another kind.

As I said, the evidence that one "kind" (whatever that is) can change into another is genetic data, which shows that one kind has changed into another. If there were some other way to explain the data, the evidence would be less persuasive, but no one has offered an alternative.

 

[Papias]

I would say the ability to produce offspring would be a kind

If you mate dogs for millions of years , you aint ever going to get a cat.... You will only get a dog. Thats what we observe throughout all of nature... There are boundaries and limits as to how far you can go in the DNA code !

God tells us what a "kind" is in Lev. 19:19, if one insists on a literal interpretation.

Lev. 19:19 'You are to keep My statutes. You shall not breed together two kinds of your cattle; you shall not sow your field with two kinds of seed, nor wear a garment upon you of two kinds of material mixed together.

To be able to mate them together, they must at least be the same species. Thus "kind" must be below species. Hence, "Kind" means "sub-species". There are many sub-species of cattle. Many examples shows that evolution is possible beyond the "kind" (subspecies) level - that one kind can evolve into another. Thus, common descent is a possible way that God created.

Thats what we observe throughout all of nature... There are boundaries and limits as to how far you can go in the DNA code !

There is ample evidence of evolution beyond the species level - both observed evolution beyond the species level as well as all the evidence proving past evolution. There is no evidence of "boundaries" in the DNA code. We've read the DNA of many animals, plants, bacteria, etc - no "boundaries" to be seen. If you know of a location in the DNA which is a "boundary", just point it out.

In fact, the many cases of speciation are so clear that creationist groups themselves say that creationists shouldn't claim that speciation isn't observed, because it is, and they'll just end up looking foolish.

Okay, so if you fuse those two chromosomes together you could say there is a superficial match - in number only

Um, they match the proposed origin chromosomes for thousands of bases long. That's like suggesting a chapter that matches letter for letter with chapter 5 of the book "The Hobbit" isn't actually from the book "The Hobbit". They even have two end to end telomeres, and a second centromere, in exactly the correct locations you'd expect if they were fused from ape chromosomes.

And that's just a start with all your posts. Should we discuss some of those points?

In Christ-
Papias

 

[Paul of Eugene OR]

I would say the ability to produce offspring would be a kind

If you mate dogs for millions of years , you aint ever going to get a cat.... You will only get a dog. Thats what we observe throughout all of nature... There are boundaries and limits as to how far you can go in the DNA code !

Please define them. Words such as you have used aren't sufficient. For example, we could declare that a mexican hairless breed is no longer a dog because it lacks hair and dogs have hair. Would that mean a new kind had come along? Why, or why not? At what point would a dog breed be so different it was another kind, and therefore prove your thesis wrong? You need to set this point up logically and reasonably before your argument can possibly have any real meaning. Because if you don't do that, then I can retort that hey, all mammals are a kind, and evolution within the mammal kind fits your criterion so it can occur. But that would put us squarely back into evolution so you won't like that option.

Get on, then, with your logical, consistent definition of what a "kind" is.

And don't tell me that its only what animals can manage to breed to become. That is circular and assumes what you are trying to prove. As I said before, all mammals are a single kind, I assert, by that definition. Indeed, going far back enough, all vertebrates are a single kind. After all we share certain inherited markers.

 

[Papias]

Please define them.

I think that Mercy-Me was saying that a "kind" is a "species". Mercy-Me said that the "ability to have offspring" defines a "kind", which sounds like the definition of "species".

However, that's unscriptural, as shown above. If those of different "kinds" could not mate and produce offspring, then there wouldn't be a law prohibiting it in Leviticus (no need to make a law against something that is impossible anyway).

In Christ-

Papias

 

[MetalGreymon]

. They are completely different and evidence for micro evolution is not evidence for macro evolution...

Well they aren't really different. They are genetic variation.
While "macroevolution" cannot be directly observed, the results are still observable in the fossil record and in our genetics which we can discuss if you're interested.

 

[MetalGreymon]

I think that Mercy-Me was saying that a "kind" is a "species".

Then she might have to re-think it because speciation is actually observable in real time.
She might mean higher taxonomic levels.

 

[MetalGreymon]

Kindly explain why "Cambrian" deep sea life forms are wrapped around mountains tops in almost mint condition when we are told they got there after millions of years of traveling through "plate tectonics."

Well since you understand the mechanism by which those fossils would arrive there, your dismissal of that mechanism is nothing more than a logical fallacy known as an argument from incredulity.
You don't know how the fossils could be "almost mint" therefore it didn't happen.

But if you'd like to debate evidence from a creation perspective, i would be happy to engage!
I will be providing evidence for evolution and you will be responsible for providing a superior explanation of that evidence from a creation perspective.
Do you accept?

Just say the word and we'll begin.

 

[Paul of Eugene OR]

I think that Mercy-Me was saying that a "kind" is a "species". Mercy-Me said that the "ability to have offspring" defines a "kind", which sounds like the definition of "species".

However, that's unscriptural, as shown above. If those of different "kinds" could not mate and produce offspring, then there wouldn't be a law prohibiting it in Leviticus (no need to make a law against something that is impossible anyway).

In Christ-

Papias

Indeed. Some creationists seek to use "kind" from the Bible as a biblical barrier to evolution but this founders when we see cattle having different "kinds" . . . Genesis 1:25, 7:14

 

[Colter]

I don't find the acceptance of evolution to be incompatible with belief in God but there are many who do.
I would like to speak to them. I will be providing evidence for evolution and you will be responsible for providing a superior explanation of that evidence from a creation perspective.

We'll begin with the fossil record.
Using an evolutionary model we would expect to see life on earth going from less complex to more complex as adaptations compound. If we look at the fossil record, this is exactly what we see. Simple invertebrates to fish to reptiles to mammals and so on. And while we do of course see simple organisms coexisting with complex ones ( just look at an earth worm) we never see something like a ichthyosaur in a fossil bed with trilobites. Nowhere. Ever.

From a creation standpoint where the animals were created at around the same time we would expect to see animals at all stages of complexity mixed together. And yet we find these fossil beds with exclusively “simple” organisms.

The fact of evolution based on the observable evidence doesn't explain where or how life began, just that it evolved from the original life development event. The conflict is between the mountain of evidence for evolution verses the Israelites creation stories(s) woven together in Genesis.

The Urantia revelation of the early 1900's reveals that celestial beings know as "Life Carriers" initiated the life patterns right here on earth (Urantia) some 550,000,000+ years ago. They remained to "foster evolution" within certain parameters. Within evolution we can see the purposive potential of Gods plan.

 

[Apex]

I don't find the acceptance of evolution to be incompatible with belief in God but there are many who do.

Your starting point is too generalized. No idea is strictly incompatible with the belief in God's existence except the idea that God doesn't exist. The real incompatibilities are in specific doctrines and theological beliefs. For example, if Adam and Eve were not the first humans, this affects our understanding of the doctrine of original sin - and subsequently soteriology. This is what you should be debating. These "science" debates are doomed from the beginning. It's never actually about the physical evidence; it boils down to how we interpret the evidence. Change your focus or you'll see a deadlock based on personal philosophical worldviews every time.

 

[Job 33:6]

@sfs

I have a quick question for you. You mentioned youre a geneticist.

Im a geologist, and while I am familiar with fossils and geology, i have my questions about evolution in regards to how it occurs on a genetic level.

If you could assist,

Basically, in regards to mutations, there is this argument that all mutations reduce "specificity" in what proteins can bind with. Or something like that.

I kind of envision the argument as, lets say an organism has a protein, that protein produces an enzyme, and that enzyme has a rectangular shaped active site. I_I , and in that active site, some rectangular shaped substrate can fit, which allows an organism to do something. Like, lets say, eat a certain type of food.

Ok, so lets say an organism mutates, a different protein is produced which leads to the creation of an enzyme that has a less specific active site. Lets say, rather than a rectangular shaped active site, this new enzyme has a big square shaped active site. I______I. So now, more substrates can fit into it, thereby giving the organism more "capabilities". There is a more open active site, allowing for a greater variety of differently shaped substrates to fit inside, like a rombus or rectangle or square or circle etc., thereby giving an organism more capabilities.

This may all sound absurd coming from a guy who studies rocks, but this is how ive interpreted the argument, and the point is that, if the enzymes only became less and less "specific" in shape, then organisms could never evolve, they could only "devolve".

So my question for sfs, is, are you aware of mutations that create an "increased specificity" in the shape of produced enzymes? And if none of this makes any sense, please explain.

Thanks!

And if anyone has any questions about geology, feel free to ask.

 

[sfs]

So my question for sfs, is, are you aware of mutations that create an "increased specificity" in the shape of produced enzymes? And if none of this makes any sense, please explain.

This sounds like Lee Spetner's proposed (and highly idiosyncratic) definition of "information", and his claim that mutations never increase information by this definition. On the face of it, the claim makes no sense, since for every mutation that decreases binding specificity (by whatever metric), there is a potential back mutation that increases the specificity. (And in something like bacteria, all potential point mutations do occur.)

Ian Musgrave had a detailed critique of Spetner's definition and claim. It's no longer at its old site on the web, but it's available through the Wayback Machine here. It includes an explanation of why mutations in ribosomes that confer antibiotic resistance do increase specificity.

 

[Papias]

@sfs

I have a quick question for you. You mentioned youre a geneticist.

.....
And if anyone has any questions about geology, feel free to ask.

sfs answered the question, but I can add a few things. First, the "specificity" approach often ignores the basics of genetics. For instance, in addition the receptor mutation you mentioned, there are many other mutations that are relevant. One of these is the duplication mutation. The duplication mutation duplicates a stretch of DNA. This can include just a few bases, a whole gene, many genes, or even a whole chromosome.

So regarding "specificity", imagine that the gene that makes a receptor is duplicated (this happens all the time). Now you have both the original receptor, and additional copies of exactly the same receptor. This would be no change from a cellular level. However, later, a mutation changes one copy of the gene (of course the other copy is unaffected). Now your cell has *both* the original receptor and the new one (like the new one you described). The new one (as sfs points out) can be more specific, less specific, or equally specific (but for a slightly different enzyme). Thus, these mutations easily give rise to greater and greater complexity (and/or greater specificity) - if that is selected for in the environment.

As in the rest of biology and genetics, it all comes down to what is selected for, because that's what determines what evolves.

Make sense?
In Christ-

Papias

 

[Job 33:6]

@sfs Thanks for the link.

What do you mean by "back mutation"?

And thanks to papias as well.

I presumed that I would get an answer like this, but without asking I could only really assume what I would hear.

If anyone has any geology or even paleo questions, feel free to ask (though most people on these forums are already pretty well versed).

 

[sfs]

What do you mean by "back mutation"

A mutation that reverses the original mutation. If a base at a particular spot in a gene mutates from an A to a G, at some later time in a descendent it can mutate from the G back to an A.

 

[Papias]

If anyone has any geology or even paleo questions, feel free to ask (though most people on these forums are already pretty well versed).

thanks! It's great to have expertise on the forum - it's often sorely needed. I might ask you a question sometime, as geology often comes up. Like just the other day - not sure if it was this thread or a different one - someone was saying that the whole geologic column is a myth.

What do you mean by "back mutation"?
.

That's pretty straightforward. It's simply a mutation that undoes a previous mutation.
for instance, say an initial DNA sequence:

GTTTAGGAGGAGGCCCGCACAACA

Mutates to:

GTTTAGGAGGTGGCCCGCACAACA

Then, later (maybe dozens of generations later, or whenever), that same base (T) happens to mutate again, back to an A:

GTTTAGGAGGAGGCCCGCACAACA

that's a "back mutation". It can of course happen with any other type of mutation too (a base deletion vs an insertion, a duplication back mutated by a deletion of the duplication, etc.)

Make sense?

Papias

 

[Job 33:6]

thanks for the reponse @sfs and @Papias

Would a back mutation be improbable given the inconsistent or unpredictable nature of mutations? I suppose given countless generations, such mutations would happen, but just out of curiosity, is this a rare occurrence? Or might there be a reason that such mutations would affect a particular gene at a particular location, more than once? Hope that makes sense.

The reason I ask is, I once read a bit about mutations that can cause subsequent mutations elsewhere in a genome, or mutations that aren't isolated in the genes they change. Are there certain genes that mutate more than others or are more susceptible to mutations than others? And in what ways can a mutation lead to changes beyond the specific gene that has mutated? I recall reading about frame shift mutations. Is there more that either of you could share?

Just curious,

Thanks.

 

[sfs]

Would a back mutation be improbable given the inconsistent or unpredictable nature of mutations? I suppose given countless generations, such mutations would happen, but just out of curiosity, is this a rare occurrence?

Depends on the population size and the length of time you're talking about. In humans, each base undergoes a substitution mutation roughly once every 100 million births. Which means pretty much every base has been mutated, probably multiple times, in the current generation, with a good chance of mutating back to the original base. For most large mammals, that would take many more generations, while for bacteria it would happen quickly. It also depends on how common the first mutation has become. If it's only a handful of individuals, then back mutation will be rare -- but the first mutation also won't matter very much.

Or might there be a reason that such mutations would affect a particular gene at a particular location, more than once?

Different parts of the genome have somewhat different mutation rates, which would affect mutations in both directions. Specific sequence motifs have different mutation rates, which usually affect one direction, since a mutation disrupts the motif. But mostly, everything mutates.

The reason I ask is, I once read a bit about mutations that can cause subsequent mutations elsewhere in a genome

A mutation that affects something like DNA replication or double-stranded break repair can increase mutations throughout the genome. Such mutations are often early steps on the road to cancer.

Are there certain genes that mutate more than others or are more susceptible to mutations than others?

See above about mutation rates.

And in what ways can a mutation lead to changes beyond the specific gene that has mutated?

Besides changing the mutation rate in other genes, they can also affect the regulation of other genes -- where and when they are expressed, and how much protein is produced. For example, a mutation in a transcription factor, which is a protein that binds to DNA to regulate genes, might affect the expression levels of all the genes that it regulates, and quite possibly other genes that they regulate.

I recall reading about frame shift mutations.

A frame shift mutation normally affects the downstream portion of the mutated gene, but not other genes.

 

[Job 33:6]

much appreciated, thanks for the input!

 

[[serious]]

Which of the 3 seperates tenants of evolution would you like to debate. 1) Natural Selection 2) Micro Evolution or 3) Macro Evolution?

That's not really the best way to break it up. I'd break it up as follows:
1. Natural selection ("Darwinism." more favored characteristics persist.)
2. Genetic heritability (Mendelian heritability and assortment)
3. Mutations (Morgan)
4. Modern synthesis (Fisher, Haldane, and Wright among others. Unification of heritability and selection)
5. Population genetics (Fisher. Definition of evolution as change in allele frequency in a population)

There are probably some other's I'm forgetting.