How We Detect Design

[SkyWriting]

Yep, here we are.

I got a lump in my throat when I read that. Thanks.

 

[DogmaHunter]

I'm a creationist so are you claiming the majority on the internet are creationist?

How you understood that from what I said is beyond me.

 

[DogmaHunter]

We are talking about proof that God does not exist, right?

No, where did you get that idea?

I even just told you that I don't even get how one could ever prove that something does not exist... Especially something as ill-defined as a god.

Besides, why would I even care to try to prove such a thing? It's not my burden to carry... It's upto those who claim a god DOES exist to support their positive claim. All I can do, is evaluate their proposed evidence. And that is, btw, also the reason why atheism isn't a "thing" or a claim... Rather, it's the response to a claim. It's not a claim by itself.

 

[DogmaHunter]

Such as?

When you have a vast and diverse productline, like the millions of species, there is always a cost to such a nested hierarchy.

Because you will inevitably end up with "legacy" stuff inside the product that is not necessary. Plenty of species have plenty of such things.

To give a very easy to understand example: wisdom teeth.
We don't need them. In most people, all they end up doing is hurting like hell and as a result, they are removed.

This is a left over directly connected to nested hierarchies.
Our mouth became smaller as our brain grew bigger. The result is that the mouth became to small for all our teeth, which we inherited from our primate ancestors.

It takes energy and resources from our bodies/biological system to build these teeth. That is a cost which is not necassary. And, I'ld argue, having them hurt like hell is also quite a cost.

Exactly the same goes for that infamous nerve which is ridiculously long in a Giraffe. It doesn't need to go all the way down the neck. It could be just 1-3 inches long if it took a direct route. This is again a cost in efficiency concerning use of resources and energy.

I could go on for quite a while, and others could pile on, but I think the point is sufficiently clear.

I own a software company. If one of my egineers would create software in such a way, I'ld fire him instantly.

First of all a nested hierarchy is a man made organizing tool originated to group organisms that had common design.

No. The nested hierarchies are factual patterns that occur in living things. It's not an arbitrary label.

Take the genomes, map out the matches and a nested hierarchy is the result.

This is objective verifiable fact. It's not arbitrary AT ALL.

Secondly, we do see similar nested hierarchy in man made designs that show for instance transportation. We see the first man made transportation systems being grouped in ever evolving designs up to today.

I challenge you to provide evidence for that claim.
I submit that you will not be able to map out cars in a nested hierarchy without encountering CLEAR and BIG violations.

I'll even throw you a bone and allow you to only use cars made by a single brand of your choosing, so that we don't have to deal with multiple designers.

Go ahead.... put your money where your mouth is.
Again, I'm flat out telling you that you can't do it. Prove me wrong.

We are the ones that are making interpretations based on past history, what do you think would be deceptive in the nested hierarchy?

Because a designer needs to go out of his way to organise his productline into a nested hierarchy. There is no good reason to do it. There are many good reasons not to do it, as I just explained: it's more difficult and it results in inneficient designs.

Evolution on the other hand, can only result in nested hierarchies.

An all-intelligent designer would know this. Going out of your way to make something look like something that it isn't.... how is that not deceptive?

You do invent fantastical stories to explain the design that appears in structures and systems in organisms which is not supported by any evidence that shows that design is an illusion.

Evolution is supported by evidence, as you have been told and shown many many times. Ignoring/denying it won't change that.

Like the faith based belief that evolution can account for the design biologists see in structures and systems in organisms?

We don't need faith to accept evidence based scientific theories.

And I submit that you have assertions and equally faith-based beliefs. You can prove me wrong by demonstrating that the design biologists see in organisms is an illusion.

You have been presented with plenty of evidence for evolution. And, as you know also, those examples presented on this forum don't even scratch the surface of what is out there in museums and science journals.

And, off course, it's not my job to carry your burden of proof.

YOU are the one claiming that there is actual design going on by an actual designer. I don't need evidence to reject your claims if you don't present any evidence for your claims.

Bare assertions are pretty meaningless.

You again mistake the issue as being one that evolution is not happen. That is not the case. Most ID proponents do accept evolution as defined.

'most'? Including you?
Then what are we arguing about here, really? What is your actual claim, if you have no problems with evolution theory?

So, do you accept that, for example, all mammals share a common ancestor?

Very few, a great minority of Christians don't believe that God was behind evolution or interjected into evolutionary processes.

Catholics kind of do though.

Which is also irrelevant. Evolution happening is not the issue. The issue is that there is no evidence of evolution providing the design apparent in organisms and their systems and structure.

You are not making any sense.
Either evolution happened or it didn't.
What you are saying here is that "it happened, but really... it didn't happen".

Are you implying I am a home-schooled Christian with no formal education?

I was making a point, not implying anything about you.
The point being that I see no reason to value the opinion of non-experts on topics where educated experts have spend decades studying it.

The idea that random non-experts understand the field of the actual millions of experts better then the actual experts is pretty silly.

 

[DogmaHunter]

So you are taking the position to not accept what the majority of scientists claim which is organisms have the appearance they were designed with a purpose? Is that what you are saying?


Explain?

Scientists are people to. They also have opinions.
Not every word coming out of a scientist's mind is going to be scientific.

Their science is found in their publications.
When they speak in poetic terms or express opinions in interviews and lectures, they are not doing any science.

I shouldn't have to explain this.....

 

[DogmaHunter]

I haven't said it was impossible.

Ow, so you agree that we simply don't know and that we might still find out?

I claim there is no supporting data
in the field of science that hints
at the idea of life forming life
from non-life
or complexity from the simple,
or intelligent or useful design
by way of natural processes.

Then you need to inform yourself. There are plenty of scientists working the field of abiogenesis. In that field, there are quite a few very plausible hypothesis that do have supportive data.

They haven't solved the puzzle yet, but they did already find quite a few pieces.

You seem to be implying that these people have nothing to research. This is, off course, not true.

There are no non-living "arrows"
pointing in the direction of life.

And the roadblocks are infinite in number.

It seems you are trying to imply "just forget about it... you'll never solve it. just accept a designer dun it and be done with it".

Is that correct?
Do you think research in abiogenesis should be stopped?

 

[DogmaHunter]

You said he doesn't see design.

“Almighty God, who is not limited in space or time, created a universe 13.7 billion years ago with its parameters precisely tuned to allow the development of complexity over long periods of time.” Emphasis mine.

This doesn't actually support your claims.......
To me, that sounds like his belief is that god kick started the big bang and then sat back and watched it unfold.

Meaning that he believes that everything that happened after the big bang unfolded naturally, according to the laws of physics in our universe.

From the development of stars, galaxies, planets, life to eventually end up with the evolved organisms we all know and love. Without any supernatural interventions to steer the course of the development of any of these things.

 

[Smidlee]

Can you show us a test to detect design, that is falsifiable?

Design is the laws of nature and the laws of physics brought under control to perform a certain function. The lightening that shoots across the sky and the electricity that going through your computer both has to obey the laws of physics. So the difference is not they both obey the laws of physics the difference is one is controlled to follow a narrow path and preforms a function and the other follows the board path going to easiest path possible. Designs will eventually lose control which ends up losing it's function as the laws of physics will break down those narrow paths. In living systems losing control leads to death.

An explosion can destroy a car as well as move a car. The difference is the explosion that moves the car is an explosion under control force to follow a narrow path. An exploding car could be designed for a purpose (to kill the driver) or an accident as the designed product lose control of the explosion but only design explains an explosion that drives a car up a hill.

How you understood that from what I said is beyond me.

Ok. I misread what you wrote. The idea that layman can't question the "experts" is what got the church in trouble centuries ago which eventually lead to the freedom of religion. By default scientist are suppose to be questioned when they can't back up their claims. It's one thing for engineers to claim they can sent a man to the moon it's another when they actual do.

 

[[serious]]

Yes, there was.
It is said that the properties of the largest structures in the Cosmos
have properties that are mirrored by the smallest structures in our world.

Everyone could see that things large things were made of parts.
They should have deduced that the smallest things would be made of parts.
Sadly, scientists refuse to believe in things they can't prove and so failed
to predict that everything has smaller components.

what about democritus?

 

[DogmaHunter]

We don't we are still learning

Evolution is a pretty solid theory. Some might say, the most solid in all of science.
We use the mechanisms in practical application as well.
In optimisation modules and agriculture for example. All the time.

We have a pretty decent understanding of it.

. claiming we are almost certain in that context remains gibberish no matter what emperor with the new clothes gambit you try to pull

Facts are facts dude...

 

[DogmaHunter]

DNA shows all the hallmarks of Intelligent design and the implausibility of it no being designed will be discussed in this thread unless you go fool some mod that it does not relate.

How did you determine that it was plausible?

 

[DogmaHunter]

Better. I can give you an illustration - DNA. You know one of the basic building blocks of life. You know what I was talking about before - the beginning of life

Your claim is not evidence of your claim.
When you claim that DNA is designed, and are asked to give a definition of design and a test of that, then repeating your claim will not do.

Better - anything that can't be shown rationally (not imaginatively) to be derived by natural processes like the complexibility of DNA and umm the origin of LIFE as I was discussing before.

So......... design-of-the-gaps, if you will?

Stop trying to shift your burden of proof. Your idea is not validated by default if a rival idea can't be shown to be correct (whatever that rival idea is).

In order to validate your idea, you actually need to come up with positive evidence that validates your idea.

Now that I have answered your question your turn

Do you have a workable provable model of abiogenesis and the Origin of LIFE

Shifting the burden of proof is not an answer to the question.

You still haven't given a proper definition of "design", nore have you given a test on how this "design" can be falsified.

You know..... the whole point of this thread is to get answers to that.

We're +20 pages in and still we have been given nothing.

 

[bhsmte]

I got a lump in my throat when I read that. Thanks.

My pleasure.

 

[DogmaHunter]

Great we will be here waiting and mean while thanks for establishing that "I dunno" is an acceptable answer to any question you should ask.

Why wouldn't "i dunno" be an acceptable answer?

If one doesn't know, isn't saying "i don't know" even the only acceptable answer?

What would you have us do instead? Lie?

 

[bhsmte]

How you understood that from what I said is beyond me.

He has a habit of creating strawmen.

 

[DogmaHunter]

That cannot be done because the source is supernatural.
Science says energy cannot be produced from nothing
yet here we are.

Therefor - gods?

If yes: argument from ignorance
If no: what is your point?

 

[Oncedeceived]

When you have a vast and diverse productline, like the millions of species, there is always a cost to such a nested hierarchy.

Because you will inevitably end up with "legacy" stuff inside the product that is not necessary. Plenty of species have plenty of such things.

To give a very easy to understand example: wisdom teeth.
We don't need them. In most people, all they end up doing is hurting like hell and as a result, they are removed.

This is a left over directly connected to nested hierarchies.
Our mouth became smaller as our brain grew bigger. The result is that the mouth became to small for all our teeth, which we inherited from our primate ancestors.

It takes energy and resources from our bodies/biological system to build these teeth. That is a cost which is not necassary. And, I'ld argue, having them hurt like hell is also quite a cost.

Exactly the same goes for that infamous nerve which is ridiculously long in a Giraffe. It doesn't need to go all the way down the neck. It could be just 1-3 inches long if it took a direct route. This is again a cost in efficiency concerning use of resources and energy.

I could go on for quite a while, and others could pile on, but I think the point is sufficiently clear.

I own a software company. If one of my egineers would create software in such a way, I'ld fire him instantly.

What you are assuming is if evolution no God and if God no evolution. You are not arguing why ID would not produce nest hierarchy but that evolution did. You are so accustomed to having an either or scenario that you can't wrap your mind around the fact that evolution is a very recent explanation for processes and histories that we have interpreted in a certain way. Evolution and its processes are not a substitution for God even though that is what some materialists would like to think. The only argument I've heard against evolution being a process that God uses to create and continue his plan is that God just wouldn't design it that way. No reasoning is given.

No. The nested hierarchies are factual patterns that occur in living things. It's not an arbitrary label.

All labels are arbitrary. They are labels of actual things but the labels are arbitrary. We could call it by any other name and it would still have the same elements within that name. The same goes for evolution, gene, genome, cell ..etc.

Now on the premise that they are factual patterns, new technologies and methods using the entire genome of living things are showing great discordance with the predicted ancestry of many many organisms that should nest with other organisms. Either you are unaware of this or you dismiss it.

Take the genomes, map out the matches and a nested hierarchy is the result.

Like I said above, you must either be unaware of the discordance of predicted histories or dismissing them. I don't know which.

This is objective verifiable fact. It's not arbitrary AT ALL.

Except due to LGT, HGT and other factors the facts are not coming up as predicted and the tree itself questioned.

I challenge you to provide evidence for that claim.
I submit that you will not be able to map out cars in a nested hierarchy without encountering CLEAR and BIG violations.

I'll even throw you a bone and allow you to only use cars made by a single brand of your choosing, so that we don't have to deal with multiple designers.

Go ahead.... put your money where your mouth is.
Again, I'm flat out telling you that you can't do it. Prove me wrong.

I don't have the time nor the desire. Living things are a different category which has a long history. Transportation a mere couple of hundreds of years.

Because a designer needs to go out of his way to organise his productline into a nested hierarchy. There is no good reason to do it. There are many good reasons not to do it, as I just explained: it's more difficult and it results in inneficient designs.

That is just an opinion that you hold. The Bible claims that life forms came from previous ones and forms which came after. Kinds although we have no definition for them do represent that living things do have groups within groups which is what we find.

Evolution on the other hand, can only result in nested hierarchies.

Except when they don't. The problems that we are seeing in the findings of Scientific experiments to prove ancestries is that the premises that evolution alone rest. We are seeing wide spread discordance in phylogenies is pointing to the premises being misinterpreted.

An all-intelligent designer would know this. Going out of your way to make something look like something that it isn't.... how is that not deceptive?

I find this so comical. Going out of your way to make something look like something that it isn't...What isn't it...what is it. It is an interpretation of how life began and adapted throughout history up to today. God isn't making things "look" like they evolved. We look at the history, see how life changed throughout history and interpret it and fit what we see into a pattern of living things. God created and engineered life to allow for adaptation and how much He was involved in that process is something ID wants to know.

Evolution is supported by evidence, as you have been told and shown many many times. Ignoring/denying it won't change that.

Evolution then evolution and the evidence that things have evolved does not give blanket explanation for everything in living things. If it does, it is no better than what you fight against. A evolution-of-the-gaps.

We don't need faith to accept evidence based scientific theories.

Yes, you do. When you don't know yet you claim it must be a materialistic answer you most certainly do take by faith what you believe.

You have been presented with plenty of evidence for evolution. And, as you know also, those examples presented on this forum don't even scratch the surface of what is out there in museums and science journals.

Scratching the surface is correct. We are now capable of breaking down the parts of life to such an extreme that we can look at the whole genome and what we are finding is not what was predicted. But what we are finding is being cloaked in new terms that cover for the discrepancies.

And, off course, it's not my job to carry your burden of proof.

Or mine yours. You do not want to stand up with your mountains of evidence and show how the design we see in life forms is an illusion. Where in all that evidence provides the evidence that this appearance is an illusion? You all shout about no evidence of design but the evidence is there and you call it an illusion. If it is an illusion it is up to you to show how it is present in all of nature.

YOU are the one claiming that there is actual design going on by an actual designer. I don't need evidence to reject your claims if you don't present any evidence for your claims.

I presented Richard Dawkins quote stating that life appears designed for a purpose but he claims this appearance is an illusion. He provides no evidence for his claim. That is what all this is about. If a worldview rests on evidence and evidence alone, where is the evidence that all that design we see in nature is an illusion?

Bare assertions are pretty meaningless.

Which is the point. It is a BARE assertion that is pretty meaningless if there is no evidence to show that this design that appears in all of nature is an illusion.

'most'? Including you?
Then what are we arguing about here, really? What is your actual claim, if you have no problems with evolution theory?

I don't believe that evolution is a process devoid of intelligence. I don't believe that evolution is a mindless process without goals or plan. Live doesn't appear to be a product of mindlessness. It doesn't appear to be without goals or plans. It shows great design and purpose. It shows planning and goals.

So, do you accept that, for example, all mammals share a common ancestor?

I have never been certain where I stand on that. I see evidence that can be interpreted that way. However, as the tree of life becomes a jumble of bush like attributes and discordance is so extensive throughout most organisms it seems less likely. It is possible, but I don't think it is anywhere near confirmed by the evidence coming out now.

Catholics kind of do though.

Some maybe.

You are not making any sense.
Either evolution happened or it didn't.
What you are saying here is that "it happened, but really... it didn't happen".

No what I am saying here is that it is not if evolution no God if God no evolution.

I was making a point, not implying anything about you.
The point being that I see no reason to value the opinion of non-experts on topics where educated experts have spend decades studying it.

Right. I can so see that is what you were saying...not.

The idea that random non-experts understand the field of the actual millions of experts better then the actual experts is pretty silly.

There are many actual experts that do not agree with other actual experts. I have provided scientific support for my conclusions. Those are from experts in their fields. Where the data is shown and conclusive I have no problem accepting their findings. When Dawkins and others claim that design is an illusion, they are not doing that from data they have found but explaining away data they have found without any evidence to do so.

 

[Loudmouth]

ID and design extends to DNA and life. LOL....you can note whatever you wish but i doubt seriously a mod will say DNA and its origin is excluded from any identification of design

Well then, perhaps you could answer this question. Using the methodology for detecting design, could you tell us if this DNA sequence is designed or not? Show us how to apply the methodology, and what the results are.

CACTCAAAGCCGGGACGCGACGCGACATAACGGCTAAGAGTAGCCCCGGAGTGTAGACCTTTGGGGTTGGATAAATCTGTCGTGGTAACCGGCTTCAACG

 

[Loudmouth]

Better. I can give you an illustration - DNA. You know one of the basic building blocks of life. You know what I was talking about before - the beginning of life

We are asking for the methodology used to determine if DNA is designed.

Better - anything that can't be shown rationally (not imaginatively) to be derived by natural processes like the complexibility of DNA and umm the origin of LIFE as I was discussing before.

How would your methodology detect a natural origin for DNA?

Now that I have answered your question your turn

Actually, you haven't. You haven't given us a scientific methodology for detecting design. Also, evolution and abiogenesis are not on topic for this thread.

 

[MikeEnders]

Could you tell us if this DNA sequence is designed or not? Show us how to apply the methodology, and what the results are.

CACTCAAAGCCGGGACGCGACGCGACATAACGGCTAAGAGTAGCCCCGGAGTGTAGACCTTTGGGGTTGGATAAATCTGTCGTGGTAACCGGCTTCAACG

Thats not a DNA sequence. Sorry