Hi, I'm taking a Philosophy class.....

[Nathan David]

If we found a tiny coded signal with any information coming from the space, we would know that there is life outside this planet, according to scientists. Now we know that cells include such amount of coded information that it would fill many encyclopaedias.

No, they don't. Cells do not contain any coded information. They contain DNA, a complex molecule that reacts in complex ways. A "code" is an arbitrary set of symbols that can only be understood by another intelligence. There is no "code" in DNA.

 

[h2whoa]

About 50 % of mutations cause decrease in information, and other 50 % are neutral. The total influence which mutations cause is that information decreases.

It's time for h2whoa's wrong-bell again

DING-DING.

You can claim all you like that that is a fact, whether you are a creationist or not.

However, as a real live geneticist I can tell you that that is an entirely made up statistic. There are numerous addition mutation that we know abou and there are plenty of beneficial mutations that we know about. So your point is fallacious.

h2

 

[Randall McNally]

Do you reject science only because it disagrees with evolution and atheism? There is a vast difference between operational science which is based on experiments and historical science which is based on suppositions.

Do you reject cosmology as well? Anthropology? Paleontology?

 

[Ondoher]

DNA is far more complex. So it would be a lot easier to believe that those things made by humans, for example computers, could have originated without ID than to believe that designers of the computers originated that way. Btw, there is analogy between DNA and computer, the second one just uses a little simpler system in order to code information.

The complexity of DNA doesn't matter one bit. DNA is not a good analogy for manufactured things, because we already know that humans manufacture these things. We cannot assume the same for DNA, doing so would be begging the question.

The basics of DNA is not that complicated to understand. It is a macro molecule that encodes instructions for proteins in triplets (called codons). The machinery of the cell reads off these codons and translates them into an amico acid sequence, thus resulting in a protein.

In once sense, your analogy with a computer was interesting. This process isn't too far removed from an instruction set of a computer, with the central processor reading the instructions sequentially and executing them. But the similarity really stops there. You can modify as much as 80% of a protein and still retain functionality. You cannot do so with a computer program. This is because much of a protein is scaffolding, with only certain amino acids being exposed for ezymatic reaction.

So, if we do not assume that life has an intelligent creator, then we must use science to try to infer the principles of nature under which it originated and diversified.

The study of the origin of life is called abiogenesis. It is an interesting field that has not yet reached a consensus, although protocells and the RNA world are complimentary ideas that have some support.

The diversity of life is under the field of evolutionary biology. This science has reached a consensus, and that consensus is that all life has descended from one, or a few, ancestral populations using the mechanisms described by the modern synthesis.

I have yet to see you advance an argument that would challenge this consensus. Complexity is not such an argument, as the modern synthesis can account for this complexity.

 

[reconciliation]

No, they don't. Cells do not contain any coded information. They contain DNA, a complex molecule that reacts in complex ways. A "code" is an arbitrary set of symbols that can only be understood by another intelligence. There is no "code" in DNA.

Cells don't contain only DNA but as well RNA. This RNA is necessary for genetic system to "read and interpret" the information coded in DNA. You are right that there couldn't be a functioning code without something that "understands" that code. But now there is!

 

[reconciliation]

There are numerous addition mutation that we know abou and there are plenty of beneficial mutations that we know about. So your point is fallacious.

Many scientists (with longer education than you have) don't believe there are any mutations that really increase information. But what is fact is that the vast majority of all mutations cause either informational decrease or don't influence the amount of information.

 

[reconciliation]

Do you reject cosmology as well? Anthropology? Paleontology?

All those are better understood on the basis of creation than with evolutionism.

 

[Mistermystery]

Many scientists (with longer education than you have) don't believe there are any mutations that really increase information. But what is fact is that the vast majority of all mutations cause either informational decrease or don't influence the amount of information.

It's a minority (if at all) in relevant field. Just because you can pay 35 bucks for a dr. title like Mr Hovind did doesn't make you an authority on the issues. And you still haven't backed up the actual numbers on how many scientists disagree with the Theory of evolution. How about you do that first before we start to take you serious again?

 

[h2whoa]

Many scientists (with longer education than you have) don't believe there are any mutations that really increase information. But what is fact is that the vast majority of all mutations cause either informational decrease or don't influence the amount of information.

No you're either very wrong or just plain lying. There are no geneticists who believe that there are no mutations that really increase mutation. This is simply a lie. There's no two ways about it really. I work with geneticists who have much longer educations than me, and this "fact" that you are presenting is not true. And I can also promise that I have a somewhat more in-depth education and experience in the area than you, and you are wrong on this.

And you have got your other fact wrong. Most mutations are either neutral, silent or deleterious. But this says nothing about the nature of the mutation. It could be a deletion a duplication or whatever. So this fact too is wrong.

But I suppose you have numerous scientific citations to prove that many scientists don't believe this very simple aspect of genetics?

h2

 

[reconciliation]

The basics of DNA is not that complicated to understand...
The diversity of life is under the field of evolutionary biology. This science has reached a consensus, and that consensus is that all life has descended from one, or a few, ancestral populations using the mechanisms described by the modern synthesis.

DNA is so complicated system that even the best scientists have to admit it isn't understood completely yet. It's no argument against design that something is different than what people make. If DNA wasn't different, then God could make only as good "products" as people can.

There is no consensus that evolution would be a fact.

 

[h2whoa]

There is no consensus that evolution would be a fact.

Are you suggesting that there is no consensus amongst the scientific community that evolution is true? Or have I misunderstood you here?

h2

 

[Randall McNally]

All those are better understood on the basis of creation than with evolutionism.

That's pretty spectacularly false.

Cosmology, which went through a major paradigm shift in the mid-20th century, is undergoing another upheaval now with the reemergence of superstring theory (now M-theory).

Paleontology and anthropology are both predicated, in part, on the validity of evolution.

 

[Nathan David]

Cells don't contain only DNA but as well RNA. This RNA is necessary for genetic system to "read and interpret" the information coded in DNA. You are right that there couldn't be a functioning code without something that "understands" that code. But now there is!

That's a series of chemical reactions, not a machine interpreting a code.

 

[Ondoher]

DNA is so complicated system that even the best scientists have to admit it isn't understood completely yet. It's no argument against design that something is different than what people make. If DNA wasn't different, then God could make only as good "products" as people can.

The point is that manufactured items are not good analogs for living things. I'm glad you agree. Now we have to do our best to understand, and our best has lead us to evolution.

There is no consensus that evolution would be a fact.

Actually, there is. By some counts 99.86% of earth and life scientists accept evolution. Sounds like a consensus to me.

 

[Mechanical Bliss]

90 % of the methods used to estimate the age of this planet point to an age far less than billions of years which would be necessary for evolution if it wasn't still impossible (it would be).

Don't lie.

Either you already know that the things you mention are not methods used to acquire the age of the earth yet pretend like they are, or else you don't know any better and made up the 90% figure on the spot to try to be impressive. Ignorance or not, you were being deliberately deceptive.

Some evidence: lack of erosion between rock layers supposed to be many millions of years old;

I guess you've never heard of unconformities then. The Grand Canyon is a great example of numerous horizontal unconformities between sedimentary rock strata and it has the famous Great Unconformity which is an angular unconformity where tilted rocks were eroded to a flat surface and horizontal sediments were deposited on top.

lack of disturbance of rock strata by worms, roots and so on;

I guess you've never heard of bioturbation then. Why can we find examples of this at all anyway? After all, we shouldn't find such bioturbation if sedimentary rock layers were deposited rapidly during a flood. In reality you are presenting evidence that proves you are wrong and apparently don't realize it because you didn't think it through very carefully.

lack of soil layers;

I guess you've never heard of paleosols, then. They are actually buried soils and are features that we find several examples of at the Grand Canyon. Soil is also easily eroded and quite insignificant in terms of how much there is. I don't see why this is a problem, especially when we do find buried soils despite your protestation to the contrary which reveals your ignorance on this topic.

polystrate fossils which traverse several rock layers vertically (they cannot have been buried during millions of years);

These are rare and such instances cannot be used to make comments on the rest of the sedimentary rock record. These have not been a problem for modern geology.

unfossilized dinosaur bones with red blood cells and hemoglobin; the amount of helium in the atmosphere (it should be 2000 times greater if the atmosphere was really billions of years old); helium in rocks (it hasn't still had much enough time to escape, surely not billions of years); lack of old supernova remnants; the amount of salt in the sea; no source of coal has been found that completely lacks carbon-14, so coal cannot be older than 50 000 years; the decay of the Earth's magnetic field; magnetic fields on "cold" planets and many other.

I'm not going to devote any more time to this PRATT list because it would not be read and it's been done before. What we have here is another example of a YEC who is in over his head and decides to prattle off a rapid PRATT list that takes only a few minutes to compile by copying creationist websites. The responses to these arguments, however, take much longer to detail.

Here is a thread I did a while ago that contains refutations to several of the arguments in the PRATT list above (salt in the oceans, magnetic field, etc.) undoubtedly taken from AiG (or analogous mirror site for their arguments), so I'll point in that direction rather than taking the time to repeat myself for someone who likely won't read the refutations:

http://www.christianforums.com/t866228


In the future, you should educate yourself from scientific resources rather than simply copying things from creationist websites and making up claims when you get in over your head in these discussions. It's better to admit your ignorance on a topic outright and try to learn rather than write arrogantly from a position of total ignorance, which only decimates your credibility here.

 

[reconciliation]

No you're either very wrong or just plain lying. There are no geneticists who believe that there are no mutations that really increase mutation. This is simply a lie.

No geneticists? I think you could as well say no scientists, right? And that shows plainly you are wrong. I don't believe you are deceiving people wilfully but if you aren't, you are suprisingly ignorant. Some examples:

Dr. Lee Spetner, a highly qualified scientist who taught information theory at Johns Hopkins University said: "All point mutations that have been studied on the molecular level turn out to reduce genetic information and not to increase it". Dr. Werner Gitt agrees and says: "...mutations can only cause changes in existing information. There can be no increase in information." I'm sure there are also many geneticists who would agree with these two so you were one who either lied or was ignorant.

 

[yossarian]

Dr. Lee Spetner, a highly qualified scientist who taught information theory at Johns Hopkins University said: "All point mutations that have been studied on the molecular level turn out to reduce genetic information and not to increase it". Dr. Werner Gitt agrees and says: "...mutations can only cause changes in existing information. There can be no increase in information." I'm sure there are also many geneticists who would agree with these two so you were one who either lied or was ignorant.

i doubt there are many, if any

lee spetner conflates specificity with information, and werner gitt introduces ridiculous concepts into his theory of information which are of no practical use

 

[Project2501]

No geneticists? I think you could as well say no scientists, right? And that shows plainly you are wrong. I don't believe you are deceiving people wilfully but if you aren't, you are suprisingly ignorant. Some examples:

Dr. Lee Spetner, a highly qualified scientist who taught information theory at Johns Hopkins University said: "All point mutations that have been studied on the molecular level turn out to reduce genetic information and not to increase it".

point mutations can decrease Shannon information, but then Shannon information is not biologically applicable anyway unless you use it carefully. This is a case of equivocation on the part of creationists

http://www.talkorigins.org/origins/postmonth/feb01.html
http://www.fred.net/tds/anti/lee.spetner/
and
http://home.mira.net/~reynella/debate/spetner.htm

Dr. Werner Gitt agrees and says: "...mutations can only cause changes in existing information. There can be no increase in information." I'm sure there are also many geneticists who would agree with these two so you were one who either lied or was ignorant.

again, the same thing. Mutations can increase Kolmogorov-Chaitin information and Spetner is in error.

rather than blanket believe either group, I suggest you go out and learn about genetics and information theory for yourself.

 

[Erstwhile_Lurker]

you are aware I hope that neither Dr. Werner Gitt or Dr. Lee Spetner has any degree in biology or genetics. So why should their word carry more weight than those who are educated in a relevant field?

 

[h2whoa]

Allow me to retort.

No geneticists? I think you could as well say no scientists, right?

That is not what I said. You are bearing false witness. You are lying.

you are suprisingly ignorant

Really. Hmmm an 18 year old is telling me that I am ignorant about matters genetic, despite my degree with Honours in Genetics and the fact that I am currently working with one of the leading functional genomics experts in Europe in order to obtain my PhD. In genetics. Hmmmm. Interesting.

Dr. Lee Spetner, a highly qualified scientist who taught information theory at Johns Hopkins University said: "All point mutations that have been studied on the molecular level turn out to reduce genetic information and not to increase it".

Ah, the scent of deliberate ambiguity (not to mention the fact it is wrong, but I'll deal with that shortly). Look closely at the passage. "All point mutations that have been studied".

Look again. "All point mutations that have been studied". Do you know what a point mutation is? I'm guessing no. I'm also guessing that Dr. Spetner has deliberately confused point mutation with all other types of mutation.

Here is a sequence:

AGGCTGGACTAACGCGCGCGGGGCATTACACTAG

Here is the same sequence with a point mutation:

AGGCTGGACTAACGCGTGCGGGGCATTACACTAG

Is there anyone here who claims that there is an increase in information here? Nope. Good.

So the good doctor is correct, there is no increase in information from a point mutation. However, this has been quoted to try and confuse lay-people into believing that the same is true for all mutations.

And anyway, the claim that all point mutations result in a loss of information is false. True, you may end up with truncated gene products or silenced genes, however you may also end up with altered proteins that are still functional, or it may be a silent mutation that results in no informational change at all. So clearly, not all point mutations result in a loss of genetic information.

Now, moving on to the idea that all mutations result in a loss of information.

Hmmmm. Duplication and insertion mutations. The names should tell you something.

Anyway, I'll let you trawl through the 3706 pages of references from the link here. I dare say some of the references won't be relevant but you'll find a few.

Such as:

Novel case of dup(3q) syndrome due to a de novo interstitial duplication 3q24-q26.31 with minimal overlap to the dup(3q) critical region.
Meins M, Hagh JK, Gerresheim F, Einhoff E, Olschewski H, Strehl H, Epplen JT.
Am J Med Genet. 2004 Nov 18.

Small de novo duplication in the repeat region of the TATA-box-binding protein gene manifest with a phenotype similar to variant Creutzfeldt-Jakob disease.
Shatunov A, Fridman E, Pagan F, Leib J, Singleton A, Hallett M, Goldfarb L.
Clin Genet. 2004 Dec;66(6):496-501.

Or this.

Or this (mentions gene duplication).

Or this.

Or this.

I'll let you find some more.

Some diseases that may be familiar are as a result of an increase in DNA that, in these particular cases, are detrimental.

Down's syndrome: you get an extra Chromosome 21 (Down's is also known as trisomy 21).

Huntington's: tri-nucleotide repeat sequence increases beyond a critical point causing disease.

Although these are examples of it causing disease, I picked them because I thought people might be familiar with the conditions. They show that yes, DNA can be added.

h2