explain fruit and vegetables by N. selection

[sbvera13]

first please answer my question, WHY did the fruit tree start producing fruit

Depends on where you want to begin. Do you want to start with seed bearing plants or with the first development of specialized reproductive cells?

 

[JBJoe]

well you dont need to tell me that ,i wholeheartedly agree

The why do you keep re-asking the question when so many have repeatedly told you? Are you hoping somebody will mistakenly say that it does?

first please answer my question, WHY did the fruit tree start producing fruit

Because the trees that produced proto-fruit were more successful than those that did not, and the trees that produced fruit were more successful than those that produced proto-fruit. You are not going to see a jump from non-fruit to fruit in a single generation. Fruit is the result of a natural selection feedback loop between the random mutations of the plant and the non-random culling of natural selection.

Now, would you give us a quantitative measure for genetic information content? We'd like to know how to measure information content such that evolving antibiotic resistance always reduces said genetic information content.

 

[Sinful2B]

Hi and welcome

WHY did the fruit tree start producing fruit

I think the answer that you are looking for, rather than hoping for, is that "It didn't".
A fruit tree, before it started producing fruit, was NOT a fruit tree.
This "NOT a fruit tree", produced many, many offspring. Each was inherantly different from it's parent and each other. OVER TIME, the differences between them became more divergent, and yet each was capable, and did, produce minute differences at every stage of their evolutionary time.
THEY HAD NO CHOICE IN THE MATTER.
Environmental interactions determined which proceeded forth, one of which, was a "NOT a fruit tree" that was NOT bearing fruit, but something akin to it. This single species eventually became fruit trees that we know today.

Perhaps I could ask you to consider a comparable.
Could you please explain to all of us here, what you know to be the differences between humans and snakes?
Simple terminology is fine. All this technical genome stuff is all very well for the technically genome minded, but it often leads to confusion. Let's keep it simple.
What are the differences between a human and a snake?
Ok?

 

[Baggins]

no my point is that you think you have it all worked out but really dont, and that is evidenced by the beliefs of 67% of americans and billions around the world

An argument from popularity, that's convincing.

I'd suggest you'd lose that battle though, the Chinese accept evolution, That's one billion, I've never heard of a hindu with problems with it, that's 2 billion, Catholics accept evolution, that's approaching half teh worlds population.

In fact you are in a pretty tiny minority, it is just that you may just be in the majority in the states and, like as a lot of Americans believe, you may consider that to be the world, but in global terms your ideas a wacky fringe of normal beliefs about origins.

And all this from someone who uses an argument about information and yet can't define information.

Your looking sooooooo good here.

 

[Baggins]

Quote:
How many times are we going to have to say evolution has no knowledge

well you dont need to tell me that ,i wholeheartedly agree

Looks like he has,at least, learnt one thing this thread, let's hope it sticks.

Creationist brains often appear to be quite leaky

 

[biggles53]

why should i have to define it ,you know what it means
you say life started with a code of say 3 letters and that over time now we have codes that are comprised of billion upon billions of letters of incredibly complex code, what im asking is how can you account for the increase in information? get it? and your answer is "mutations" well prove it , dont try and shove your theory down my throat and call it a fact of life unless you can back it up,

mutations have never been shown to create entirely new instructions and info, they only scramble what was already there ,

this goes out to everyone unless you have some proof of this i dont want to hear your whinging about me not understanding the tenents of evolution, i am not an expert but i understand what is theory and what is fact in the TOE and natural selection and speciation is the only fact in it, the rest is theory and presupposition

Sigh.....

This from TalkOrigins - even you will understand it huggy...if you choose to...:

1. It is hard to understand how anyone could make this claim, since anything mutations can do, mutations can undo. Some mutations add information to a genome; some subtract it. Creationists get by with this claim only by leaving the term "information" undefined, impossibly vague, or constantly shifting. By any reasonable definition, increases in information have been observed to evolve. We have observed the evolution of
2. increased genetic variety in a population (Lenski 1995; Lenski et al. 1991)

• increased genetic material (Alves et al. 2001; Brown et al. 1998; Hughes and Friedman 2003; Lynch and Conery 2000; Ohta 2003)
• novel genetic material (Knox et al. 1996; Park et al. 1996)
• novel genetically-regulated abilities (Prijambada et al. 1995)

1. 
   If these do not qualify as information, then nothing about information is relevant to evolution in the first place.

1. A mechanism that is likely to be particularly common for adding information is gene duplication, in which a long stretch of DNA is copied, followed by point mutations that change one or both of the copies. Genetic sequencing has revealed several instances in which this is likely the origin of some proteins. For example:
2. Two enzymes in the histidine biosynthesis pathway that are barrel-shaped, structural and sequence evidence suggests, were formed via gene duplication and fusion of two half-barrel ancestors (Lang et al. 2000).

• RNASE1, a gene for a pancreatic enzyme, was duplicated, and in langur monkeys one of the copies mutated into RNASE1B, which works better in the more acidic small intestine of the langur. (Zhang et al. 2002)
• Yeast was put in a medium with very little sugar. After 450 generations, hexose transport genes had duplicated several times, and some of the duplicated versions had mutated further. (Brown et al. 1998)

1. The biological literature is full of additional examples. A PubMed search (at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi) on "gene duplication" gives more than 3000 references.
2. According to Shannon-Weaver information theory, random noise maximizes information. This is not just playing word games. The random variation that mutations add to populations is the variation on which selection acts. Mutation alone will not cause adaptive evolution, but by eliminating nonadaptive variation, natural selection communicates information about the environment to the organism so that the organism becomes better adapted to it. Natural selection is the process by which information about the environment is transferred to an organism's genome and thus to the organism (Adami et al. 2000).
3. The process of mutation and selection is observed to increase information and complexity in simulations (Adami et al. 2000; Schneider 2000).

 

[Wiccan_Child]

thankyou ,you are the only one to understand or is honest enough to answer my question, hats off to you , so my answer to that is that the fruit was there because it was gods intention for it to be there,that it didnt evolve as defense or anything else

There are an infinite number of explanations. But guess which one is most probable? Guess which one is supported by evidence? Guess which one isn't religious presupposition?

indeed the whole of the TOE is based on the premise that mutations can create entirely new instructions and information ,but this is yet to be proven,

Not really. Ever heard of superbugs? Bacteria have evolved resistances to our antibiotics and other medicines over the past century alone. Mutations in bacteria cause changes in antigens, and those with antigens that just so happen to resist a particular antibiotic are the ones that survive. This is called evolution. This is how 'information' is evolved.

More to the point, there is no such thing as a 'law of conservation of information' outside of quantum mechanics.

sorry you should check your stats, the world is comprised of 19percent muslim who believe in creation,and 33 percent christian who believe in creation, and just to save you the trouble yes christians and muslims believe in natural selection and speciation,they dont however believe in common descent, so that makes 52% then you have all the other minor religions to go along with that ,

Source? The majority of Christians believe in common descent. It is only the fundamentalist minority that reject scientific knowledge for religious dogma.

and oh what about the recent poll that showed that 67% of americans dont believe in common descent ? i think i have my stats right thankyou

In case you hasn't noticed, the US leads the world in scientific ignorance. The rest of the world (bar Turkey) has higher levels of public support for common descent. Indeed:

Notice how only six countries don't have over 50% of the population that believe in common descent. The majority side with me. Does that mean I win?

 

[FishFace]

why should i have to define it ,you know what it means

I know what information means, of course I do. But you are saying that information only decreases in this context. What I do not have is a quantifiable definition of information. You need to give me an algorithm - which will be your definition - with which I can take two genomes side by side and work out which one has more information.

Of course, you'll have a hard time doing this because mutations are random. So if we suppose that sequence A has more information than what it mutated into:

A = ACATGTGGAC
B = ACATGTCGAC

Then a mutation on sequence B could produce:

C = ACATGTGGAC

Which is an increase in information.

you say life started with a code of say 3 letters and that over time now we have codes that are comprised of billion upon billions of letters of incredibly complex code, what im asking is how can you account for the increase in information? get it? and your answer is "mutations" well prove it , dont try and shove your theory down my throat and call it a fact of life unless you can back it up

Life can't have started with a code because that would require the material for the code and the material the code would transcribe to present all at once, and also the mechanisms to do all that. No, at first there was no code. But we're not talking about abiogenesis here, so let's suppose we have a rudimentary organism with a small genome. Now, this sequence is far too small, but we'll simplify matters:

1: ACGGAAATACGTC

Now, one kind of mutation that tends to occur is a duplication mutation:

2: ACGGAAATACGTCACGGAAATACGTC

Now, in the language of an information theorist, this requires one more bit of information (as in a computer bit, not a colloquial "part"), because we now have to give the information of the original sequence, and also the information that there are two copies.
I suppose your algorithm will tell us how both of these sequences have just the same amount of information. Now, suppose the organism has another mutation:

3: ACGGAGATACGTCACGGAAATACGTC

Now we no longer have two identical sequences, so this, I thought, has much more information. But you see that we still have the original sequence, so even if, were we to look at each "half" of this genome separately, this latest mutation destroyed the information in that half, we still have the original sequence here, so it doesn't matter. Mutations can continue to happen, and eventually produce something new.

mutations have never been shown to create entirely new instructions and info, they only scramble what was already there ,

Well, they have been shown to do all they need to do - they can produce an entirely new function, such as the ability to digest nylon. (Please note, if you don't want to read wikipedia, there are links to peer-reviewed articles at the bottom.)

 

[[serious]]

i am interested to hear evolutionists explain via natural selection things like

[list below]
and the list goes on

if all life is the result of survival of the fittest and mutation by necessity ,how do you explain all these things ? what is it about the avocado tree that it needed to grow avocados to survive? and the tomato and so on, the point i am trying to prove is that you simply cannot account for all life on earth by natural selection,

no evo trolls are to post on this thread and no answers that lack any good sense and or reasoning

avocados: likely a seed dispersal mechanism coevolved with now extinct giant sloth. propagated by humans for 1000 years or more

apples: most common varieties are domestic and as such artificially selected. likely originally evolved as seed transport device

oranges: again, a domestic hybrid. ancestors likely used the fruits as a seed dispersal mechanism

peaches: seed dispersal

apricots: seed dispersal

bananas: domestic fruit. artificially created

chillis: domesticated LONG ago. the heat part was possibly originally a method of protecting the fruit from fauna.

broccoli: domestically bred from wild cabbage

grain: domestically bred from wild grasses

potatoes: domesticated. tuber likely originated as a energy storage device.

carrots: domesticated. simple taproot.

beans: another long domesticated group. seed.

snow peas: domestic variety. seed.

onion: most varieties domestic. bulb used for wintering of wild plants.

tomatoes: heavily domesticated seed transport device

coconuts: stone type fruit able to float for dispersion.

garlic: same as onion

olives: very domesticated stone fruit. originally a seed dispersion mecanism

pineapples: not sure. possibly seed dispersion device turned to seed energy reserve

corn: very heavily domesticated grass.

herbs and spices: various.

 

[Split Rock]

you have ignored what i said , i admitted the question should have been worded better, and that i understand speciation and natural selection, and microevolution

If you understand natural selection, why do you keep asking how did the tree knew it needed to evolve fruit? Go back and re-read the definition I gave you.

but i think you know that, my question is i will say it again , is how does the fruit come about about in the first place ?

Fruit evolved from ovaries by natural selection as a seed dispersal mechanism. The more tasty the ovary was, the more likely it was eaten by animals and released elsewhere through defecation. Eventually the ovary became quite enlarged with plenty of carbohydrates to entice animals to use it as a food source.

and the same goes for everything else, where does the information come from? i am not expecting an answer from you, as you just claim i dont understand speciation and natural selection

You continue to refuse to define "information" in this context. If you want to know where DNA came from as a storage chemical for genetic information, the answer lies with Abiogenesis (chemical evolution) rather than with biological evolution.

christians dont deny these things as we believe that god created the original taxons or kinds and then down through time speciation accounts for the diversity, but you know that, and yes i have read multitudes of data on evolution, so my original question remains unanswered

Explain to us what this model predicts and what could potentially falsify it.

 

[AintNoMonkey]

I think huggybear abandoned this thread once he realized he'd been thoroughly pwned.

QUIT TROLLING, YOU'RE TROLLING YOU TROLL THIS IS A TROLL-FREE ZONE, OFFICER HUGGY IS ON PATROLL, YOU TROLLER.

troll

 

[JBJoe]

http://www.youtube.com/watch?v=TU-7d06HJSs

Fast forward to 4:35. This woman repeats the "no new genetic information" argument. Fast forward again to 6:28 and tell me if you think AronRa just predicted exactly what happened here.

 

[RecentConvert]

why should i have to define it ,you know what it means
you say life started with a code of say 3 letters and that over time now we have codes that are comprised of billion upon billions of letters of incredibly complex code, what im asking is how can you account for the increase in information? get it? and your answer is "mutations" well prove it , dont try and shove your theory down my throat and call it a fact of life unless you can back it up,

Yes, we know what "information" means and yes, random mutation (and natural selection) can produce new information. So, if you claim that random mutation can't possibly produce new information, you must be using a different definition of information than the rest of us. That's why you should define it...

mutations have never been shown to create entirely new instructions and info, they only scramble what was already there ,

This is simply untrue. Random mutation can duplicate and scramble information and, thus, produce new information...

this goes out to everyone unless you have some proof of this i dont want to hear your whinging about me not understanding the tenents of evolution, i am not an expert but i understand what is theory and what is fact in the TOE and natural selection and speciation is the only fact in it, the rest is theory and presupposition

We have incontravertible evidence of common ancestry and the mechanism of evolution is perfectly plausible. Biologists have met their burden and so the onus is on you to disprove it...

 

[suzmot]

I think with creationists we need to adopt a simpler approach, maybe Huggybear is a visual learner. Unfortunately I can't post pictures yet, but here goes!

Huggybear: Humans generally have 5 fingers on each hand (including the thumb)

There are many humans who, through random mutations are born with 6 fingers.

Is this the type of "new information" that you suggest is impossible?

 

[FishFace]

Messy, that's probably the wrong way to go about things. That will not count as "new information" because it is a duplication of an existing feature. Of course, if we used an objective measure of the information in the genome, it would probably have gone up.

It would be nice if huggy could come along and give us his objective, quantifiable definition which never goes up (even if a mutation happens and then is reversed)