• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

Evolution/Creation on Trial

Status
Not open for further replies.

joshua 1 9

Well-Known Member
Site Supporter
May 11, 2015
17,420
3,593
Northern Ohio
✟314,607.00
Country
United States
Gender
Male
Faith
Christian
Marital Status
Married
What you're missing is that none of the things we're unsure about are particularly crucial to the theory.
That is the nature of science. We can only present the evidence that we have to present. It is not like we can manufacture it somewhere. Then that very same evidence is open for everyone to examine and well you tell me what we do with the evidence we have. You explain it a lot better then I can.

but the fact that we don't know everything is not a contraindication to those core ideas, as every single piece of evidence we have ever uncovered fits the theory.
This holds true for Evolution and Creationism. Both are restricted to working with the evidence we currently have to work with. So they deal with the same limitations.

The "ideology" of science? Science is not an ideology. It's an epistemology. It is a way of knowing things. Furthermore, it is the only consistently reliable way of knowing things that I am aware of. The application of science has moved us from a group of nomadic hunter-gatherers on the savanna to essentially the dominant lifeform on the planet. The reason we teach science is because of how universally and demonstrably useful it is.
There is no doubt that Moses and Abraham were men of science. They were very well educated in their day. Moses in Egypt and Abraham as a Chaldean in the city of Ur.

So basically, the fact that science works is a very strong indication that there is no significant supernatural interference in nature.
God does not violate the natural laws that He created. He restores them back to His purpose and intention. If it's broke He fixes it as good as new or better. He is working to redeem and to restore. Sometimes He leaves a record or evidence of what He does and sometimes it is hidden and He does not reveal everything to us.

The Bible can help us to understand natural law and how those laws work.

I wonder how do you explain the observer effect?
 
Upvote 0

joshua 1 9

Well-Known Member
Site Supporter
May 11, 2015
17,420
3,593
Northern Ohio
✟314,607.00
Country
United States
Gender
Male
Faith
Christian
Marital Status
Married
maybe.
it will not be easy to purge society of greed, hate, and jealousy.
all societies that i'm aware of have their own brand of nationalism and patriotism, this in itself leads to a number of conflicts.
Dealing with differences in culture is a real challenge. America has been a melting pot experiment. Yet Evolution works best with diversity. You want to avoid bottlenecks.

the atomic bomb has already done that.
there will never be another "world war", if there is, it will be the last thing the human race will do.
Albert Einstein, in an interview with Alfred Werner said WW4 will be fought with sticks and stones. During Vietnam a $26 round of ammo could take out a multi million dollar tank. Weapons today depend on electronics that can be easily defeated with an electronic bomb. I have wondered why police still like to chase the bad guy. It would be easy to zap their ignition so their vehicle would not run. They have researched that technology, but for now they do not want to develop it.
 
Upvote 0

The Cadet

SO COOL
Apr 29, 2010
6,290
4,743
Munich
✟60,617.00
Gender
Male
Faith
Atheist
Marital Status
In Relationship
Politics
US-Democrat
This holds true for Evolution and Creationism. Both are restricted to working with the evidence we currently have to work with. So they deal with the same limitations.

Fundamentally, creationism rejects this restriction and inserts a supernatural entity with powers we cannot observe or examine.

I wonder how do you explain the observer effect?

I recommend Wikipedia. I wonder what this has to do with the topic.
 
Upvote 0

joshua 1 9

Well-Known Member
Site Supporter
May 11, 2015
17,420
3,593
Northern Ohio
✟314,607.00
Country
United States
Gender
Male
Faith
Christian
Marital Status
Married
Fundamentally, creationism rejects this restriction and inserts a supernatural entity with powers we cannot observe or examine.
The challenge is to present scientific evidence for the Bible. Only that presents the same limits that the theory of evolution has to deal with. We have a limited amount of evidence to work with. So we have to make do with what we have.
 
Upvote 0

bhsmte

Newbie
Apr 26, 2013
52,761
11,792
✟262,441.00
Faith
Atheist
Marital Status
Single
Politics
US-Others
Hello Bhsmte.

Do you mind if I comment on this statement of yours.



There is no real alternative to evolutionary biology in the education system, so of course
they would agree. They have been deeply conditioned into the ideology of science itself, thats
what the education system is designed to do.

Where I have issues with the scientific explanation of everything it seems, from the Big Bang
through to the evolution of mankind. Is that there appears to be a number of assumptions
and axioms, that are sown into the fabric of these scientific explanations. Yet they are rarely
advertised, probably for good reason.

The first and greatest assumption that science by default accepts, is that there is no
interference in the natural world by God. Science is forced to hold this assumption,
otherwise, if a God did interfere in nature, then any study and measurement of nature
would be at best be an unreliable exercise.

The second assumption that science must hold onto at all cost. Is that all events in the
distant past occurred at the same rate, and over the same time period, exactly the same
as these events occur in the present era. If these events in the past took place in a shorter,
or longer time frame, then the time frames for dating would be erroneous.

For example, it is assumed by science that strata layers, are laid down over vast periods
of time. Science has no absolute method for dating these strata layers, that is without
the assumption of an initial uniform concentration. Decay rates of isotopes, e.t.c.,
must also be uniform. There is no room in science for any non uniformity in the distant past.
In science, because it is an ideology, must hold a myriad of assumptions to be true.
If the assumptions are not true, then the conclusions of science would be erroneous.

There exists this wide agreement of evolution, because of the enormous amount of objective evidence to support the theory.

And, science does not include any super natural forces in their theories because; THERE IS NO EVIDENCE OF ANY.

Of course, if you would like science to include things that simply make you more comfortable with your personal faith belief, you will indeed be disappointed.
 
Upvote 0

The Cadet

SO COOL
Apr 29, 2010
6,290
4,743
Munich
✟60,617.00
Gender
Male
Faith
Atheist
Marital Status
In Relationship
Politics
US-Democrat
The challenge is to present scientific evidence for the Bible. Only that presents the same limits that the theory of evolution has to deal with. We have a limited amount of evidence to work with. So we have to make do with what we have.

I'm not sure what this has to do with anything. What do you mean "evidence for the Bible"? The Bible is a collection of disparate claims, many of which cannot even in principle be supported by evidence. Proving one thing from the bible does not prove anything else; Spiderman is not real simply because New York City exists.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Sure is, and it's done by breed mating with breed producing new breeds within the species. And has nothing to do with evolution,

Still avoiding the evidence that humans and chimps share a common ancestor?

No, he's just referring to the evolutionary dogma that one can do anything without the other already in place with the abilities to interact.

The only unevidenced claim is that those other structures had to be there for the other structure to be useful. That is what ID/creationists never evidence.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Living systems are a lot more complex than simple computer programs. Evolutionist can not back up their claims that evolution has to produce a nested hierarchy they can only assume it.

We observe that evolution produces a nested hierarchy.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1800920/

Your video assume you can compare human DNA with another creature DNA just like you would compared human DNA with another human DNA. It assumes what makes you human is totally your DNA. Note that's a assumption not a fact.

It is a demonstration of tons of science in the field of Evolutionary Developmental Biology.

http://evolution.berkeley.edu/evolibrary/article/evodevo_01

We know how homeobox genes work. We know how gene cascades produce morphology. We know how cells differentiate into tissues. It works through DNA.

It appears that you want to create this fog of ignorance so that creationism can survive. Why is that?

If you put human DNA in a chicken egg it's a scientific fact the chicken egg will try to develop a chicken and not a human.

This I have to see. Reference?

These mathematical models are way too simplistic and are totally based on evolution assumptions. It's the same as those mathematical models that claims an eyeball can evolved in 250,000 generations.

Is that all you have? Denial?
 
Upvote 0

Paulos23

Never tell me the odds!
Mar 23, 2005
8,491
4,862
Washington State
✟397,524.00
Country
United States
Gender
Male
Faith
Atheist
Marital Status
Married
Politics
US-Others
The Bible can help us to understand natural law and how those laws work.

Given that most of what we understand of natural law we learned despite what is said in the Bible, and in some cases trying to prove a part of the Bible and ending up disproving it, I don't see how you can claim the Bible holds any understanding on how the natural world works.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
The majority of those biologist who involved in the ENCODE project believes over 80% of human genome were functional and DarwinisT attack the results as if ENCODE was done by creationist. :)

We attack it as if it were bad science, because it is. Their definition of functional DNA includes junk DNA. Their definition in no way incorporates the fitness of the individual which is nonsense.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
So 99% agree that we can not know for sure. I mean that is fine that they agree with evolution, only evolution itself has more holes in it than swiss cheese.

At least there is cheese. With creationism, there isn't even any cheese there. They have zero. It is all holes and no cheese. Yes, there are specific evolutionary pathways that we still don't understand, BUT WE ARE STUDYING THEM. Can that be said of creationism? Where are the active creationist research groups? What science are they doing? What are the mechanisms that creationists have discovered for how life was created? What were the steps for creating animals? What were the steps for creating the bacterial flagellum? What mechanisms were used?

Where is there any creationist science? I will take swiss cheese over empty air any day.

I have no disagreement with you. My problem is with science and their rather high degree of uncertainty.

Yet you go with creationism that only has uncertainty with zero science to back it. That's a double standard.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Simple? Translate some hieroglyphics and Chinese text for me. Those are simple.

You are shifting the burden of proof. It is the ID/creationists who claim that DNA sequences can only be produced by an intelligence and contain information. Prove it. Here is another DNA sequence. Using ID/creationism, tell us if only a designer could produce that sequence, describe the methodologies that you used, and tell us what the information is in that DNA.

CGTGCCCCACCGTTGGCAGTACGATCGCACGCCCCACGTGAACGATTGGTAAACCCTGTGGCCTGTGAGCGACAAAAGCTTTAATGGGAAATACGCGCCC
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
I am not denying the evidence. I am not denying anything. I simply point out that science is not as sure of itself as you seem to think they are.

You simply make the claim, which isn't true. As others have mentioned, with the ability to rapidly sequence entire genomes, evolution is as sure as germ theory.

Your claim that Biology is 99% sure of what they believe simply does not hold up.

Why? Because you say so?
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
According to the Biology book: "a precise definition of species is not always possible".

That's exactly what we should see if evolution is true.

So it looks like science maybe having a bit of trouble knowing for sure just what a species is.

That's because evolution blurs the lines between species.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
I don't use it to express my point of view other than showing that evolution is implied within the Genesis Narrative and I don't need to know what Kind is to know that it implies this. However, we do know there is some kind of limits to evolution as some studies have shown this.

What are these studies? Would current biodiversity go beyond those limits if it shared a common ancestor? If so, show how.

Perhaps. Yet we are seeing a great deal of discordance in those "nests" when we have the entire genome to go by.

Yet another claim that isn't backed by anything.
 
Upvote 0

In situ

in vivo veritas
May 20, 2013
1,754
324
Amsterdam
✟38,212.00
Faith
Agnostic
Marital Status
Private
can someone please present a non-scientist like myself with ... evidence .... one of these should directly relate to the claim that one type of creature (e.g., a reptile) can turn into a bird, with some examples of actual creatures where this has happened

For example, take a look at this post I made today.
 
Upvote 0

joshua 1 9

Well-Known Member
Site Supporter
May 11, 2015
17,420
3,593
Northern Ohio
✟314,607.00
Country
United States
Gender
Male
Faith
Christian
Marital Status
Married
Given that most of what we understand of natural law we learned despite what is said in the Bible, and in some cases trying to prove a part of the Bible and ending up disproving it, I don't see how you can claim the Bible holds any understanding on how the natural world works.
Sorry you just broke the irony meter. What we know we have learned DESPITE the opinions of people about the Bible. IE man's interpretation.
 
Upvote 0

joshua 1 9

Well-Known Member
Site Supporter
May 11, 2015
17,420
3,593
Northern Ohio
✟314,607.00
Country
United States
Gender
Male
Faith
Christian
Marital Status
Married
You simply make the claim, which isn't true. As others have mentioned, with the ability to rapidly sequence entire genomes, evolution is as sure as germ theory.
I just don't know about germ theory so I guess I will have to take your word for it. What I do know is about diet and how obesity, diabetes, heart disease and cancer are all epidemic at this point in time and science has failed mankind in dealing with this crises. You have to present evidence and the evidence right now when it comes to diet shows every indication that science is failing to get the job done. Evolution has LOTS to contribute to the discussion and not once has anybody on this board taken up the challenge to try and use the theory of evolution to determine what sort of a diet we evolved to eat. If the theory of evolution is true then the last thing we should be eating is McDonald's. So you can all pat yourselves on the back and congratulate yourselves on how wonderful your theory is, but until you apply that theory to help deal with the catastrophic epidemics that plague us today then you have accomplished nothing.

The Story of the Human Body: Evolution, Health, and Disease

Starred Review. In thoroughly enjoyable and edifying prose, Lieberman, professor of human evolution at Harvard, leads a fascinating journey through human evolution. He comprehensively explains how evolutionary forces have shaped the human species as we know it, from the move to bipedalism, and the changes in body parts—from hands to feet and spine—that such a change entailed, to the creation of agrarian societies, and much more. He balances a historical perspective with a contemporary one—examining traits of our ancestors as carefully as he looks to the future—while asking how we might control the destiny of our species. He argues persuasively that cultural evolution is now the dominant force of evolutionary change acting on the human body, and focuses on what he calls mismatch diseases that are caused by lack of congruence between genes and environment. Since the pace of cultural evolution has outstripped that of biological evolution, mismatch diseases have increased to the point where most of us are likely to die of such causes. Lieberman's discussion of type 2 diabetes, heart disease, and breast cancer are as clear as any yet published, and he offers a well-articulated case for why an evolutionary perspective can greatly enrich the practice of medicine.

Like it or not, we are slightly fat, furless, bipedal primates who crave sugar, salt, fat, and starch. Harvard professor Lieberman holds nothing back in his plea that people listen to the story of human evolution consisting of five biological transformations (walking upright, eating a variety of different foods, accumulating physical traits aligned to hunting and gathering, gaining bigger brains with larger bodies, and developing unique capacities for cooperation and language) and two cultural ones (farming and reliance on machines). Unfortunately, human beings now create environments and presently practice lifestyles that are clearly out of sync with the bodies they’ve inherited. This mismatch results in myriad problems, including Type 2 diabetes, myopia, flat feet, and cavities. Lieberman cleverly and comprehensively points out the perils of possessing Paleolithic anatomy and physiology in a modern world and bemoans just how out of touch we have become with our bodies. Natural selection nudges all life-forms toward optimality rather than a state of perfection. If we want to continue our phenomenal run as a species, it is essential to understand (and embrace) our evolutionary legacy.
 
Last edited:
Upvote 0
Status
Not open for further replies.