Does evolution have a chance?

[Tomk80]

NDT assumes and requires that

1. The mutations that occur are very small. The smallest possible steo is assumed. ie single nucleotide substitutions.

Nope. Deletions of larger parts can occur. Single nucleotide substitutions are not the only possible small changes. Copying, deletions and insertions can insert large stretches of DNA, even whole genes. It regularly happens also. The effects of the mutations must be small, the mutations themselves do not have to be.

2. The mutations are random.

Which they are.

3. It is a logical requirement that the net result of this process from the first theorised living cell to say the present day person involves a net gain in information.

And why couldn't this happen. Copy a gene and there is more information (information for two genes, in stead of one). If the original or the copy mutates (for example through base substitution) to produce a different gene, it will produce two different genes.

Can I assume that if a reasonable example of such a process is given, you'll drop your claim that the requirements for 'NDT' cannot be met?

 

[Micaiah]

If you can find a mutation that meets these requirements I think that you can say you have found a mutation that meets these requirements.

 

[Tomk80]

If you can find a mutation that meets these requirements I think that you can say you have found a mutation that meets these requirements.

And then you will retract your claim that they don't exist here on this thread? I want to have this absolutely sure, so I do not go on a medline/pubmed search to see you move goalposts. Sorry if that offends you, but I've been chasing goalposts for too many times now, so I do not want to get into something like that. Are there any other criteria you can now think of in advance, so that I don't suddenly get new criteria when I come up with an example.

 

[mark kennedy]

There are no images of either Homo neandertalensis nor Homo floresiensis, nor any of the other human subspecies in this image, because Homo sapiens is the only species of human still around. Ours is a globally-interbreeding population, and has been since the invention of the boat. So we can't really generate a new species anymore. You knew that of course, so I suspect you only said this to dodge the argument about the dogs, and obfuscate what you couldn't address about the rest of the points I made.

It was the mention of sub-species that triggered my response, I wasn't really concerned with anything else. These dems are the result of gene expression changing overtime but the actual genes are virtually identical. Now as far as inbreeding worldwide there might be a couple of wrinkles there. Humans are geologically isolated from time to time over a number of generations. What happens is a bottleneck effect and I have yet to see an adaptive trait follow limited gene flow.

Which is still pretty good for a globetrotting species that was never completely isolated, right?
And how much would we have to change to evolve from mammals?
Oh yeah, we are mammals.

Wait a minute, we're still apes too!

It sure takes a lot to get kicked out of that family doesn't it? We are mammals and globetrotting apes, ok great. Now where is the part where we identify the genetic mechanisms that explain the exponential expansion of the ape brain in size, weight and complexity?

I guess we didn't have to change one iota to evolve from them then, did we?

Oh we would have had to change a great deal. In 6 million years some 40 million nucleotides would have had to completly change genome wide. Thats about 6.66 nucleotides being substituted, inserted or deleted every year for six million years. Then there are chromosomal rearrangements that average about 3.5 nucleotides rearranged per year for the same period. Never mind that this never happens in nature, we have to assume our common ancestory with apes as an apriori, self-evident fact.

Have a nice day
Mark

 

[Valkhorn]

Oh we would have had to change a great deal. In 6 million years some 40 million nucleotides would have had to completly change genome wide. Thats about 6.66 nucleotides being substituted, inserted or deleted every year for six million years. Then there are chromosomal rearrangements that average about 3.5 nucleotides rearranged per year for the same period. Never mind that this never happens in nature, we have to assume our common ancestory with apes as an apriori, self-evident fact.

Where do you get this from?

Can you possibly cite your sources?

 

[perplexed]

I am am by no means an expert but
if there are 3 billion nucleotides and a chimp has 97% similarity then Mark's figures seem to be in the right ball park. Since if 1% of a billion is 10 million and the claim is that chimps and humans came from the same common ancestor 6 million years ago, so humans and chimps must have been changing by around 1% in the those 6 million years.

 

[perplexed]

I just found a link backing up 40 million nucleotides and the idea things happened fast

http://news.nationalgeographic.com/news/2005/08/0831_050831_chimp_genes.html

 

[Valkhorn]

I just found a link backing up 40 million nucleotides and the idea things happened fast

http://news.nationalgeographic.com/...himp_genes.html

Well considering that humans and chimps have a common ancestor and that chimps didn't directly evolve into humans what mark kennedy is saying may have a few problems to say the least.

Really the nucleotide differences would be less and the time involved would theoretically be greater.

But, let's suppose that there are 40 million changes over 6 million years - that relates to 6-7 changes per year, or for 20 generations 120-140 changes per each generation.

Is that possible? Well according to this, http://en.wikipedia.org/wiki/Nucleotide -

Nucleotides are just the letters in genetic code, so that in this random sequence:

GAATTTCAAATCCCGGAGTTTCATCAAAAGTGGGACCC

each letter resembles a nucleotide.

Now even species that are remarkably similar and even twins are not perfect clones - that is to say that the nucleotide sequence will naturally be different from generation to generation.

According to http://www.ornl.gov/sci/techresources/Human_Genome/faq/compgen.shtml#genomesize,
There are approxomitely 2,900,000,000 base pairs in one human.

Even if there are 300 changes in the base pair sequence from one generation to the next that would mean that only 0.0000103% has changed from generation A to generation B.

Yes, Mark is saying that somewhere around 0.0000103% change from generation to generation is impossible.

Now that is amusing.
http://news.nationalgeographic.com/news/2005/08/0831_050831_chimp_genes.html

 

[Micaiah]

The only mutations that are passed onto offspring are those that occur in either the egg or sperm. The rate of point mutations in the DNA is about 1 in 10 billion.

 

[Tomk80]

The only mutations that are passed onto offspring are those that occur in either the egg or sperm. The rate of point mutations in the DNA is about 1 in 10 billion.

As far as I know, that is too low an estimate. According to this article, it's a fair bit higher.

It has been estimated that in humans and other mammals, uncorrected errors (= mutations) occur at the rate of about 1 in every 50 million (5 x 107) nucleotides added to the chain. (Not bad — I wish that I could type so accurately.) But with 6 x 109 base pairs in a human cell, that mean that each new cell contains some 120 new mutations.

 

[perplexed]

Well considering that humans and chimps have a common ancestor and that chimps didn't directly evolve into humans what mark kennedy is saying may have a few problems to say the least.

That is a trivial difference that is only involves that can at most double or halve estimates.

If humans and chimps had a common ancestor 6 million years ago and 97% similarity the total change of chimps and humans is 3 %. If humans directly evolved from chimps then just the humans need a 3% change.

 

[Aron-Ra]

It was the mention of sub-species that triggered my response, I wasn't really concerned with anything else. These dems are the result of gene expression changing overtime but the actual genes are virtually identical. Now as far as inbreeding worldwide there might be a couple of wrinkles there.

Wait a minute, what would inbreeding have to do with any of this?

Humans are geologically isolated from time to time over a number of generations.

We're geologically isolated? We're separated by rocks? And yet that doesn't prevent in-breeding?

What happens is a bottleneck effect and I have yet to see an adaptive trait follow limited gene flow.

If you're really concerned about the bottleneck effect, then Adam and Noah must present two very serious problems for you. But if you want an example of an adaptive trait following limited gene flow, (and I know you really don't want one) take a look at the CCR5-delta 32 mutation. About 10% of whites of European origin now carry it. But the incidence is only 2% in central Asia, and is completely absent among East Asians, Africans, and American Indians. It appears to have suddenly become relatively common among white Europeans about 700 years ago, evidently as a result of the Black Plague, indicating another example of natural selection allowing one gene dominance in a changing environment. It is harmless (or neutral) in every respect other than its one clearly beneficial feature; if one inherits this gene from both parents, they will be especially resistant (if not immune) to AIDS.

Wait a minute, we're still apes too!

It sure takes a lot to get kicked out of that family doesn't it?

It can't be done. You can change your future, but you can't change your past, and you certainly can't change your ancestry.

We are mammals and globetrotting apes, ok great. Now where is the part where we identify the genetic mechanisms that explain the exponential expansion of the ape brain in size, weight and complexity?

Every time I ask you this, you change the subject. How much does an ape have to change for it to still be an ape? You're still a mammal, right? I mean, why do you accept that you are a mammal, if we had to change so much more to have evolved from them? How many nucleotides had to change for that to happen, Mark? Because we exactly no more different from "mammals" than we are from monkeys or even Eukaryotes. And look how far we had to evolve from them! And yet we're still Eukaryotes too! Can you evolve from any of these groups without still being one of them? Is it possible to change that much?

Oh we would have had to change a great deal. In 6 million years some 40 million nucleotides would have had to completly change genome wide. Thats about 6.66 nucleotides being substituted, inserted or deleted every year for six million years. Then there are chromosomal rearrangements that average about 3.5 nucleotides rearranged per year for the same period.

Yet look what a 0.0000103% change per generation would accomplish after closer to ten million years at an average of only 14 or 15 years per generation.

Never mind that this never happens in nature,

Yes it does, Mark. And this could be easily demonstrated for you, if you dare look at reality. Name any two examples of animal lineages you like, and we'll explore that, shall we?

we have to assume our common ancestory with apes as an apriori, self-evident fact.

You don't have to accept it. In fact, faith literally means not accepting anything you don't want to believe, no matter if its true or not. And that is your positon. But if you were to challenge it, (as you keep refusing to do) then you would quickly see that it is a self-evident -even demonstrable fact. That's why you had to dodge all my direct questions when this came up in our private debate.

 

[Aron-Ra]

The only mutations that are passed onto offspring are those that occur in either the egg or sperm. The rate of point mutations in the DNA is about 1 in 10 billion.

As far as I know, that is too low an estimate. According to this article, it's a fair bit higher.

He knows that already. I recently showed him references to a couple different medical research facilities which each proved that every human zygote inherits more than 100 mutations at the point of conception. He's just using the typical creationist tactic of re-using arguments even after you know they're are wrong, because your opponant might not know that yet.

 

[Micaiah]

As previously noted, the links you posted contradicted these claims.

It is unlikely that genetic adaptation has occurred in Andean populations as a result of the generation and promulgation of new alleles over the last 12000 years. The mutation frequency in humans is approximately 10-6 per meiosis per gene, and the probability of a beneficial variant arising is much lower.

It has been estimated that in humans and other mammals, uncorrected errors (= mutations) occur at the rate of about 1 in every 50 million (5 x 107) nucleotides added to the chain. (Not bad — I wish that I could type so accurately.) But with 6 x 109 base pairs in a human cell, that mean that each new cell contains some 120 new mutations.

My estimate may be a bit out because it was given as the mean rate in organisms other than bacteria. We're talking here about copying errors after thaey have been checked. I'd be interested to see other references on the topic that meet this criteria.

 

[Micaiah]

Did some more research on human DNA point mutation rates. The magical number seems to be 2x10^-8, though this is inferred in some interesting ways and not the result of direct measurement of the DNA. I noted the statement in several places that the mutation rate of humans is significantly higher than in apes. There are thought to be mutation 'hot spots' on the DNA ie. locations where mutations are more likely to occur.

It has been found in recent times that the mutation rates in the mitochondrial DNA is significantly higher than previously expected. Some of these rates indicate that we descended from a common mother known as mitochondrial Eve about 6000 years ago. But that's another story.

 

[Dal M.]

Some of these rates indicate that we descended from a common mother known as mitochondrial Eve about 6000 years ago. But that's another story.

"Another story" or not, I - and most biologists, I imagine - would be extremely interested to hear about any evidence that placed mitochrondrial Eve as recently as 6,000 years ago.

 

[Micaiah]

See new thread

 

[Aron-Ra]

I recently showed him references to a couple different medical research facilities which each proved that every human zygote inherits more than 100 mutations at the point of conception.

As previously noted, the links you posted contradicted these claims.

No they didn't. Read them again, and this time, look at all of the words.

"It is unlikely that genetic adaptation has occurred in Andean populations as a result of the generation and promulgation of new alleles over the last 12000 years. The mutation frequency in humans is approximately 10-6 per meiosis per gene, and the probability of a beneficial variant arising is much lower.
It has been estimated that in humans and other mammals, uncorrected errors (= mutations) occur at the rate of about 1 in every 50 million (5 x 107) nucleotides added to the chain. (Not bad — I wish that I could type so accurately.) But with 6 x 109 base pairs in a human cell, that mean that each new cell contains some 120 new mutations."

My

estimate may be a bit out because it was given as the mean rate in organisms other than bacteria. We're talking here about copying errors after thaey have been checked. I'd be interested to see other references on the topic that meet this criteria.

OK. This was the quote from the National Center for Biotechnology Information:

"Our data suggest an overall mutation rate of 2.14x10-8 per base per generation, or 128 mutations per human zygote."

Now, where do you see a contradiction between my claim and the links I provided to support it?

 

[Edx]

bump

 

[Micaiah]

I acknowledge this is the number evolutionists typically use as noted above in post 195.

The magical number seems to be 2x10^-8, though this is inferred in some interesting ways and not the result of direct measurement of the DNA.

I may have misunderstood this post which seemed to indicate a much higher rate of mutation.

"New variance comes from mutations at a rate approximately 10-2 to 10-4 VE per generation. VM should be equal to 2nua2, where n is the number of genes which can mutate to have effect on the trait, u is the per locus mutation rate, and a is the effect of the mutation. We can estimate nu from mutation accumulation experiments (like Mukai 1972). For viability, nu is in the range 0.1 to 1. This means that either the mutation rate is extremely high, or there are many loci which mutate to affect viability."

Also, I note that the mutation rate used for evolution should refer to point mutations and is typically quoted after checking, which eliminates many of the mutations. The above post referred to uncorrected mutations.