Creationism - Lazy Man's science?

[Kripost]

The point is that President Clinton and Francis Collins consider DNA to be the langage of God.

The word 'language' is a metaphor in this context, and not an actual language.

 

[Pete Harcoff]

Kind of sucks for anyone who died in 1610, then.

No kidding. Kind of makes you wonder why it took several thousand years for God's Word to reach its zenith. You think He could have got it right the first time.

 

[Beastt]

Other animals dont ask questions, they just eat, sleep, play, and that's about it.

Is it possible that you really can't tell when an animal is asking a question or trying to understand something?

You're attempting to apply human values of intelligence to animals. Were you do reverse that and apply the values of another particular species to humans, you might decide humans weren't so clever.

You should really spend a bit more time becoming familiar with what non-human animals can and can't do. Certainly they're not as intelligent as humans, but they do show the ability to think, to be curious, to ask questions, recount traumatic instances in their lives and express affection.

http://www.koko.org/world/journal.phtml?offset=10

http://www.discover.com/issues/jan-00/features/featpolly/

http://www.edge.org/3rd_culture/pepperberg03/pepperberg_index.html

 

[Beastt]

Genesis 1:3-5
And God said, Let there be light: and there was light. [4] And God saw the light, that it was good: and God divided the light from the darkness. [5] And God called the light Day, and the darkness he called Night. And the evening and the morning were the first day.

The mechanism is that God said. Jesus we are told is the word of God and it is though the Word that God created us. DNA then is the language of God.

You continually claim to understand the Bible and to have some understanding of God. So speak a little DNA for us.

What do you suppose this means; "CAATCTAGCGACCGATCGGTCTAACGTTCTCA"?
HINT: 0100001101110010011000010110001101101011011100000110111101110100
Personally, I don't see any logic behind such a claim. It seems pretty obvious to most people that if there is any kind of universal or "ultimate" language, it would have to be binary. Even the conversion of binary to the four letters representing the various components of DNA is a relatively simple task. Break any binary representation into segments of 2 digits, (bits), and you have only 4 possibilities. Simply assign each to a specific component of DNA and you're done. It simply makes far more sense to use only two states than to utilize more. Of course the more states/symbols you use, the shorter any visual representation must be. But four isn't exactly the epitome of brevity so obviously, if there was any kind of sentient plan behind the structure of DNA, it wasn't designed with brevity in mind.

 

[JohnR7]

So speak a little DNA for us.

I did order the book, but I do not think that it will be here until monday. We can talk about it then.
Right now I am reading a book that someone else wanted to talk about.

 

[NASAg03]

Is it possible that you really can't tell when an animal is asking a question or trying to understand something?

You're attempting to apply human values of intelligence to animals. Were you do reverse that and apply the values of another particular species to humans, you might decide humans weren't so clever.

You should really spend a bit more time becoming familiar with what non-human animals can and can't do. Certainly they're not as intelligent as humans, but they do show the ability to think, to be curious, to ask questions, recount traumatic instances in their lives and express affection.

http://www.koko.org/world/journal.phtml?offset=10

http://www.discover.com/issues/jan-00/features/featpolly/

http://www.edge.org/3rd_culture/pepperberg03/pepperberg_index.html

good point, although i think some of that comes as a result of us domesticating them and them learning our human ways. but none of that is beneficial to them as a species. look at domesticated animals in the wild - they can't survive. they have compromised their natural instincts for more human emotions, and as a result are inept at surviving.

this begs the question of how love and compassion can be good for a species, and how this lines up with evolution and "survival of the fittest". by feeling empathy and love, and caring for the weaker part of the species, we are compromising the survival of the better species.

think about it like this: a weaker member of your species is getting attacked. you feel obliged because of love to help out this member of your species (or even a dog or cat in the case of some humans), putting your life at risk.

why weren't these traits of love, compassion and morality "filtered" out through evolution???

 

[Beastt]

good point, although i think some of that comes as a result of us domesticating them and them learning our human ways. but none of that is beneficial to them as a species. look at domesticated animals in the wild - they can't survive. they have compromised their natural instincts for more human emotions, and as a result are inept at surviving.

Much as most humans can survive only for a very limited time outside of our protected little micro-environments.

But I'm glad you hit upon the very important point that the things they learn from us in captivity are of very little use to them in the wild. Yet when we see them doing the things we teach them, we think of them as displaying intelligence. When we see them acting more naturally in the wild, we perceive them to be less intelligent. The point is that they are doing what helps them to survive in each situation. What we consider valuable in a business exchange isn't going to assist us in surviving alone in a rain forest. If we can adapt to our environment, we have a better chance of survival. But we sit in one environment and view them in a different environment and consider them to be too stupid to think, simply because the demands of the two environments are so vastly diverse. In reality, we're the ones not using our intelligence because we're attempting to rate their intelligence based on our standards and values which apply best in our environment, not theirs.

this begs the question of how love and compassion can be good for a species, and how this lines up with evolution and "survival of the fittest".

Let me start with the last part; "survival of the fittest". That's probably the most wide-spread of the misconceptions concerning evolution. Darwin never said that nor does the theory endorse that. What Darwin said was, "In the struggle for survival, the fittest win out at the expense of their rivals because they succeed in adapting themselves best to their environment."

If you're not terribly familiar with the theory of evolution, you might not see the significance in what he did say, verses what people are always attempting to quote him as saying. You'd be much closer if you said, "survival of the most adaptable". It's not being fit, in a sense of strength and health, which allows a species to survive, it's the adaptability. The species with the greatests ability to adapt to environmental changes, becomes the most fit for that particular environment. And through that adaptability, survives.

As for love and compassion, those are extremely successful evolutionary adaptations. Look to nature and note how common social groups are. We've even developed a large gathering of various words just to describe the social groups of various species and other groups. We have gams, pods, prides, murders, packs, herds, shrewdness, colony, sleuth, sloth, piteousness, convocation, cast, skulk, gaggle, skein, covey, bloat, charm, cackle, and smack, to name a few. That doesn't mean that all of these various social gatherings of animals are driven by love and compassion, but love and compassion are apparent in several species such as elephants, humans, meerkats and wolves. It's one of the things which effectively bonds the animals together, helps them to work together, and by working together, gives them a survival advantage. Several wolves can hunt more effectively than a single wolf. Several killer whales can bubble-net much more effectively than can a single orca. And people are certainly more effective at meeting the challenges of their environment when working together to do so.

by feeling empathy and love, and caring for the weaker part of the species, we are compromising the survival of the better species.

This isn't quite the way it works out. It might look that way when one notices a large, healthy, strong wolf dragging part of the kill back to an injured member of the pack. But the cooperation is a two-way street. Even the strongest member of a social group is subject to unjury and disease. When they are too sick to hunt, it may be the member they helped who brings food home to them. Vampire bats do the same thing. They're small and have very fast metabolisms so they can starve in just two or three days if they become sick, injured or otherwise unable to fly and feed. The cooperative effort between the members helps to limit the occassions when a survivable injury would lead to death.

think about it like this: a weaker member of your species is getting attacked. you feel obliged because of love to help out this member of your species (or even a dog or cat in the case of some humans), putting your life at risk.

But this also helps to assure that when you are attacked by greater numbers, the likelihood that others of your group will come to your aid is greater.

why weren't these traits of love, compassion and morality "filtered" out through evolution???

Because they're extremely successful evolutionary adaptations. They came about because they increase the potential for survival.

 

[AV1611VET]

Let me start with the last part; "survival of the fittest". That's probably the most wide-spread of the misconceptions concerning evolution. Darwin never said that nor does the theory endorse that. What Darwin said was, "In the struggle for survival, the fittest win out at the expense of their rivals because they succeed in adapting themselves best to their environment."

Well you'll have to excuse us Christians then, Beastt, because these are NOT Christian principles. All this fighting and inbreeding and struggling to survive goes against God's creation.

The God of the Bible is NOT the God of Evolution --- He never would have sanctioned it.

 

[Pete Harcoff]

Well you'll have to excuse us Christians then, Beastt, because these are NOT Christian principles. All this fighting and inbreeding and struggling to survive goes against God's creation.

The God of the Bible is NOT the God of Evolution --- He never would have sanctioned it.

Er... Aren't we talking about the same God who flooded the entire world killing off 90%+ of the living things, just because He wasn't happy with how things turned out?

 

[Beastt]

Well you'll have to excuse us Christians then, Beastt, because these are NOT Christian principles. All this fighting and inbreeding and struggling to survive goes against God's creation.

(Psalms 68:21-23) "But God shall wound the head of his enemies, and the hairy scalp of such a one as goeth on still in his trespasses. The Lord said, I will bring again from Bashan, I will bring my people again from the depths of the sea: That thy foot may be dipped in the blood of thine enemies, and the tongue of thy dogs in the same."

(Deuteronomy 13:8-9) "Thou shalt not consent unto him, nor hearken unto him; neither shall thine eye pity him, neither shalt thou spare, neither shalt thou conceal him: But thou shalt surely kill him; thine hand shall be first upon him to put him to death, and afterwards the hand of all the people."

(Deuteronomy 13:15) "Thou shalt surely smite the inhabitants of that city with the edge of the sword, destroying it utterly, and all that is therein, and the cattle thereof, with the edge of the sword."

(I Samuel 15:2-3) "Now go and smite Amalek, and utterly destroy all that they have, and spare them not; but slay both man and woman, infant and suckling, ox and sheep, camel and ass."

(Numbers 31:16-18) "Now therefore kill every male among the little ones, and kill every woman that hath known man by lying with him. But all the women children, that have not known a man by lying with him, keep alive for yourselves."

(Isaiah 13:15-16) "Every one that is found shall be thrust through; and every one that is joined unto them shall fall by the sword. Their children also shall be dashed to pieces before their eyes; their houses shall be spoiled, and their wives ravished."

(Ezekiel 9:5-6) "And to the others he said in mine hearing, Go ye after him through the city, and smite: let not your eye spare, neither have ye pity: Slay utterly old and young, both maids, and little children, and woman: but come not near any man upon whom is the mark; and begin at my sanctuary. Then they began at the ancient men which were before the house."

(Psalms 58:10) "The righteous shall rejoice when he sees the vengeance. He shall wash his feet in the blood of the wicked."​

You were saying?

The God of the Bible is NOT the God of Evolution --- He never would have sanctioned it.

I agree with you on this point. I believe that evolution is decidedly contrary to the claims of the Bible. There is nothing about any slow spawning of diversity. Genesis gives an account of many different types of creatures, some from the sea, others from the land and all within a verse or two. It makes no reference to that which I can find to correlate with evolution.

Having said that; evolution is what we have. It's real, it's demonstrable, it's documented, filmed, photographed and utilized very successfully in many fields of science and it operates as predicted by the theory of evolution. Evolution is what reality offers. Everything else is but the offering of an old book filled with tales, superstitions and demonstrably fallacious claims. So it comes to each of us to choose. You can find truth in what demonstrates itself to be true or you can deny truth and thrust yourself into the bowels of a fictional book... and there are many from which to choose.

 

[AV1611VET]

Er... Aren't we talking about the same God who flooded the entire world killing off 90%+ of the living things, just because He wasn't happy with how things turned out?

Let's stay focused, Pete. We're discussing Creation vs Evolution. Anything beyond Genesis 1 can be addressed later --- okay?

 

[AV1611VET]

You were saying?

I were saying that has nothing do do with Creation. After the Fall things changed, but let's stick with Genesis 1, okay?

Having said that; evolution is what we have. It's real, it's demonstrable, it's documented, filmed, photographed and utilized very successfully in many fields of science and it operates as predicted by the theory of evolution.

I don't know what you've been watching, but evolution has NEVER been filmed, photographed, and utilized, or it wouldn't be called the Theory of Evolution --- it would just be Evolution.

Again, Evolution takes much too long, and this Earth just hasn't been here nearly long enough; but we've already covered that ground.

 

[AV1611VET]

Given that Christians believe their God to be unchanging, I'm inclined to believe it's simply more convenient for your agrument to temporarily ignore those things in your Bible which lie contrary to what you're attempting to claim.

Have at it, Pete.

You're gonna attempt to drag me beyond Genesis 1, and it's not going to work. Again --- we're discussing Creation vs Evolution --- for now.

 

[Beastt]

I were saying that has nothing do do with Creation. After the Fall things changed, but let's stick with Genesis 1, okay?

No, it's not okay. You were objecting to evolution and stating that your God wasn't the God of Evolution because it wasn't within his nature. As most Christians consider the Bible to be the word of this unchanging God, there is no reason that anything in the Book shouldn't be used to represent the nature of this proclaimed God.

The only reason you might object to anything in the Bible being used against your argument is that it's very effective against your argument and you'd prefer not to have your own book used to refute your own assertions.
r it wouldn't be called the Theory of Evolution --- it would just be Evolutio

I don't know what you've been watching, but evolution has NEVER been filmed, photographed, and utilized,

You're likely under this false impression because many churches don't tell their members about all of the evidences for evolution. I've had a few come to my door who stand speechless for several seconds when I hand them a list.

Would you like the short list?

1. M Nei and J Zhang, Evolution: molecular origin of species. Science 282: 1428-1429, Nov. 20,

1998. Primary article is: CT Ting, SC Tsaur, ML We, and CE Wu, A rapidly evolving homeobox at the

site of a hybrid sterility gene. Science 282: 1501-1504, Nov. 20, 1998. As the title implies, has

found the genes that actually change during reproductive isolation.
2. M Turelli, The causes of Haldane's rule. Science 282: 889-891, Oct.30, 1998. Haldane's rule

describes a phase every population goes thru during speciation: production of inviable and sterile

hybrids. Haldane's rule states "When in the F1 [first generation] offspring of two different

animal races one sex is absent, rare, or sterile, that sex is the heterozygous [heterogemetic; XY,

XO, or ZW] sex."Two leading explanations are fast-male and dominance. Both get supported. X-linked

incompatibilities would affect heterozygous gender more because only one gene."
3. Barton, N. H., J. S. Jones and J. Mallet. 1988. No barriers to speciation. Nature. 336:13-14.
4. Baum, D. 1992. Phylogenetic species concepts. Trends in Ecology and Evolution. 7:1-3.
5. Rice, W. R. 1985. Disruptive selection on habitat preference and the evolution of reproductive

isolation: an exploratory experiment. Evolution. 39:645-646.
6. Ringo, J., D. Wood, R. Rockwell, and H. Dowse. 1989. An experiment testing two hypotheses of

speciation. The American Naturalist. 126:642-661.
7. Schluter, D. and L. M. Nagel. 1995. Parallel speciation by natural selection. American

Naturalist. 146:292-301.
8. Callaghan, C. A. 1987. Instances of observed speciation. The American Biology Teacher. 49:3436.
9. Cracraft, J. 1989. Speciation and its ontology: the empirical consequences of alternative

species concepts for understanding patterns and processes of differentiation. In Otte, E. and J.

A. Endler [eds.] Speciation and its consequences. Sinauer Associates, Sunderland, MA. pp. 28-59.

Chromosome numbers in various species
http://www.kean.edu/~breid/chrom2.htm

Speciation in Insects
1. G Kilias, SN Alahiotis, and M Pelecanos. A multifactorial genetic investigation of speciation

theory using drosophila melanogaster Evolution 34:730-737, 1980. Got new species of fruit flies in

the lab after 5 years on different diets and temperatures. Also confirmation of natural selection

in the process. Lots of references to other studies that saw speciation.
2. JM Thoday, Disruptive selection. Proc. Royal Soc. London B. 182: 109-143, 1972.
Lots of references in this one to other speciation.
3. KF Koopman, Natural selection for reproductive isolation between Drosophila pseudobscura and

Drosophila persimilis. Evolution 4: 135-148, 1950. Using artificial mixed poulations of D.

pseudoobscura and D. persimilis, it has been possible to show,over a period of several

generations, a very rapid increase in the amount of reproductive isolation between the species as

a result of natural selection.
4. LE Hurd and RM Eisenberg, Divergent selection for geotactic response and evolution of

reproductive isolation in sympatric and allopatric populations of houseflies. American Naturalist

109: 353-358, 1975.
5. Coyne, Jerry A. Orr, H. Allen. Patterns of speciation in Drosophila. Evolution. V43. P362(20)

March, 1989.
6. Dobzhansky and Pavlovsky, 1957 An incipient species of Drosophila, Nature 23: 289- 292.
7. Ahearn, J. N. 1980. Evolution of behavioral reproductive isolation in a laboratory stock of

Drosophila silvestris. Experientia. 36:63-64.
8. 10. Breeuwer, J. A. J. and J. H. Werren. 1990. Microorganisms associated with chromosome

destruction and reproductive isolation between two insect species. Nature. 346:558-560.
9. Powell, J. R. 1978. The founder-flush speciation theory: an experimental approach. Evolution.

32:465-474.
10. Dodd, D. M. B. and J. R. Powell. 1985. Founder-flush speciation: an update of experimental

results with Drosophila. Evolution 39:1388-1392. 37. Dobzhansky, T. 1951. Genetics and the origin

of species (3rd edition). Columbia University Press, New York.
11. Dobzhansky, T. and O. Pavlovsky. 1971. Experimentally created incipient species of Drosophila.

Nature. 230:289-292.
12. Dobzhansky, T. 1972. Species of Drosophila: new excitement in an old field. Science.

177:664-669.
13. Dodd, D. M. B. 1989. Reproductive isolation as a consequence of adaptive divergence in

Drosophila melanogaster. Evolution 43:1308-1311.
14. de Oliveira, A. K. and A. R. Cordeiro. 1980. Adaptation of Drosophila willistoni experimental

populations to extreme pH medium. II. Development of incipient reproductive isolation. Heredity.

44:123-130.15. 29. Rice, W. R. and G. W. Salt. 1988. Speciation via disruptive selection on

habitat preference: experimental evidence. The American Naturalist. 131:911-917.
30. Rice, W. R. and G. W. Salt. 1990. The evolution of reproductive isolation as a correlated

character under sympatric conditions: experimental evidence. Evolution. 44:1140-1152.
31. del Solar, E. 1966. Sexual isolation caused by selection for positive and negative phototaxis

and geotaxis in Drosophila pseudoobscura. Proceedings of the National Academy of Sciences (US).

56:484-487.
32. Weinberg, J. R., V. R. Starczak and P. Jora. 1992. Evidence for rapid speciation following a

founder event in the laboratory. Evolution. 46:1214-1220.
33. V Morell, Earth's unbounded beetlemania explained. Science 281:501-503, July 24, 1998.

Evolution explains the 330,000 odd beetlespecies. Exploitation of newly evolved flowering plants.
34. B Wuethrich, Speciation: Mexican pairs show geography's role. Science 285: 1190, Aug. 20,

1999. Discusses allopatric speciation. Debate with ecological speciation on which is most

prevalent.

Speciation in Plants
1. Speciation in action Science 72:700-701, 1996 A great laboratory study of the evolution of a

hybrid plant species. Scientists did it in the lab, but the genetic data says it happened the same

way in nature.
2. Hybrid speciation in peonies http://www.pnas.org/cgi/content/full/061288698v1#B1
3. http://www.holysmoke.org/new-species.htm new species of groundsel by hybridization
4. Butters, F. K. 1941. Hybrid Woodsias in Minnesota. Amer. Fern. J. 31:15-21.
5. Butters, F. K. and R. M. Tryon, jr. 1948. A fertile mutant of a Woodsia hybrid. American

Journal of Botany. 35:138.
6. Toxic Tailings and Tolerant Grass by RE Cook in Natural History, 90(3): 28-38, 1981 discusses

selection pressure of grasses growing on mine tailings that are rich in toxic heavy metals. "When

wind borne pollen carrying nontolerant genes crosses the border [between prairie and tailings] and

fertilizes the gametes of tolerant females, the resultant offspring show a range of tolerances.

The movement of genes from the pasture to the mine would, therefore, tend to dilute the tolerance

level of seedlings. Only fully tolerant individuals survive to reproduce, however. This selective

mortality, which eliminates variants, counteracts the dilution and molds a toatally tolerant

population. The pasture and mine populations evolve distinctive adaptations because selective

factors are dominant over the homogenizing influence of foreign genes."
7. Clausen, J., D. D. Keck and W. M. Hiesey. 1945. Experimental studies on the nature of species.

II. Plant evolution through amphiploidy and autoploidy, with examples from the Madiinae. Carnegie

Institute Washington Publication, 564:1-174.
8. Cronquist, A. 1988. The evolution and classification of flowering plants (2nd edition). The New

York Botanical Garden, Bronx, NY.
9. P. H. Raven, R. F. Evert, S. E. Eichorn, Biology of Plants (Worth, New York,ed. 6, 1999).
10. M. Ownbey, Am. J. Bot. 37, 487 (1950).
11. M. Ownbey and G. D. McCollum, Am. J. Bot. 40, 788 (1953).
12. S. J. Novak, D. E. Soltis, P. S. Soltis, Am. J. Bot. 78, 1586 (1991).
13. P. S. Soltis, G. M. Plunkett, S. J. Novak, D. E. Soltis, Am. J. Bot. 82,1329 (1995).
14. Digby, L. 1912. The cytology of Primula kewensis and of other related Primula hybrids. Ann.

Bot. 26:357-388.
15. Owenby, M. 1950. Natural hybridization and amphiploidy in the genus Tragopogon. Am. J. Bot.

37:487-499.
16. Pasterniani, E. 1969. Selection for reproductive isolation between two populations of maize,

Zea mays L. Evolution. 23:534-547.

Speciation in microorganisms
1. Canine parovirus, a lethal disease of dogs, evolved from feline parovirus in the 1970s.
2. Budd, A. F. and B. D. Mishler. 1990. Species and evolution in clonal organisms -- a summary and

discussion. Systematic Botany 15:166-171.
3. Bullini, L. and G. Nascetti. 1990. Speciation by hybridization in phasmids and other insects.

Canadian Journal of Zoology. 68:1747-1760.
4. Boraas, M. E. 1983. Predator induced evolution in chemostat culture. EOS. Transactions of the

American Geophysical Union. 64:1102.
5. Brock, T. D. and M. T. Madigan. 1988. Biology of Microorganisms (5th edition). Prentice Hall,

Englewood, NJ.
6. Castenholz, R. W. 1992. Species usage, concept, and evolution in the cyanobacteria (blue-green

algae). Journal of Phycology 28:737-745.
7. Boraas, M. E. The speciation of algal clusters by flagellate predation. EOS. Transactions of

the American Geophysical Union. 64:1102.
8. Castenholz, R. W. 1992. Speciation, usage, concept, and evolution in the cyanobacteria

(blue-green algae). Journal of Phycology 28:737-745.
9. Shikano, S., L. S. Luckinbill and Y. Kurihara. 1990. Changes of traits in a bacterial

population associated with protozoal predation. Microbial Ecology. 20:75-84.

New Genus
1. Muntzig, A, Triticale Results and Problems, Parey, Berlin, 1979. Describes whole new *genus* of

plants, Triticosecale, of several species, formed by artificial selection. These plants are

important in agriculture.

Invertebrate not insect
1. ME Heliberg, DP Balch, K Roy, Climate-driven range expansion and morphological evolution in a

marine gastropod. Science 292: 1707-1710, June1, 2001. Documents mrorphological change due to

disruptive selection over time. Northerna and southern populations of A spirata off California

from Pleistocene to present.
2. Weinberg, J. R., V. R. Starczak and P. Jora. 1992. Evidence for rapid speciation following a

founder event with a polychaete worm. . Evolution. 46:1214-1220.

Vertebrate Speciation
1. N Barton Ecology: the rapid origin of reproductive isolation Science 290:462-463, Oct. 20,

2000. www.sciencemag.org/cgi/content/full/290/5491/462 Natural selection of reproductive isolation

observed in two cases. Full papers are: AP Hendry, JK Wenburg, P Bentzen, EC Volk, TP Quinn, Rapid

evolution of reproductive isolation in the wild: evidence from introduced salmon. Science 290:

516-519, Oct. 20, 2000. and M Higgie, S Chenoweth, MWBlows, Natural selection and the

reinforcement of mate recognition. Science290: 519-521, Oct. 20, 2000
2. G Vogel, African elephant species splits in two. Science 293: 1414, Aug. 24, 2001.

www.sciencemag.org/cgi/content/full/293/5534/1414
3. C Vila` , P Savolainen, JE. Maldonado, IR. Amorim, JE. Rice, RL. Honeycutt, KA. Crandall,

JLundeberg, RK. Wayne, Multiple and Ancient Origins of the Domestic Dog Science 276: 1687-1689, 13

JUNE 1997. Dogs no longer one species but 4 according to the genetics.

http://www.idir.net/~wolf2dog/wayne1.htm
4. Barrowclough, George F.. Speciation and Geographic Variation in Black-tailed Gnatcatchers.

(book reviews) The Condor. V94. P555(2) May, 1992
5. Kluger, Jeffrey. Go fish. Rapid fish speciation in African lakes. Discover. V13. P18(1) March,

1992.
Formation of five new species of cichlid fishes which formed since they were isolated from the

parent stock, Lake Nagubago. (These fish have complex mating rituals and different coloration.)

See also Mayr, E., 1970. _Populations, Species, and Evolution_, Massachusetts, Harvard University

Press. p. 348
6. Genus _Rattus_ currently consists of 137 species [1,2] and is known to have
originally developed in Indonesia and Malaysia during and prior to the Middle
Ages[3].
[1] T. Yosida. Cytogenetics of the Black Rat. University Park Press, Baltimore, 1980.
[2] D. Morris. The Mammals. Hodder and Stoughton, London, 1965.
[3] G. H. H. Tate. "Some Muridae of the Indo-Australian region," Bull. Amer. Museum Nat. Hist. 72:

501-728, 1963.
7. Stanley, S., 1979. _Macroevolution: Pattern and Process_, San Francisco,
W.H. Freeman and Company. p. 41
Rapid speciation of the Faeroe Island house mouse, which occurred in less than 250 years after man

brought the creature to the island.

Speciation in the Fossil Record
1. Paleontological documentation of speciation in cenozoic molluscs from Turkana basin.

Williamson, PG, Nature 293:437-443, 1981. Excellent study of "gradual" evolution in an extremely

find fossil record.
2. A trilobite odyssey. Niles Eldredge and Michelle J. Eldredge. Natural History 81:53-59, 1972. A

discussion of "gradual" evolution of trilobites in one small area and then migration and

replacement over a wide area. Is lay discussion of punctuated equilibria, and does not overthrow

Darwinian gradual change of form. Describes transitionals

 

[JohnR7]

Given that Christians believe their God to be unchanging, I'm inclined to believe it's simply more convenient for your agrument to temporarily ignore those things in your Bible which lie contrary to what you're attempting to claim.

The Bible is the book of life. So it contains all of life and all of the known universe. Even if we had all knowledge and all understanding so we could solve every mystory known to man and science, it is not enough. Because without love, then we are nothing and we have nothing.

Science does not claim to know everything and have all of the answers, so why do you feel that we should?

 

[AV1611VET]

No, it's not okay. You were objecting to evolution and stating that your God wasn't the God of Evolution because it wasn't within his nature. As most Christians consider the Bible to be the word of this unchanging God, there is no reason that anything in the Book shouldn't be used to represent the nature of this proclaimed God.

Believe me, Beastt, the Bible is a twoedged sword, and I know when to use it, and when not to. Again, God created the universe in 6 days --- much too short of time for evolution --- don't you think?

FYI, here are my top 4 questions again:

• 1. How can Evolution work within the scope of a 6000-year universe?
  2. Since God created the universe "perfect", why the need for evolution?
  3. Since Jesus believed in Creation, why should His followers believe in Evolution?
  4. Don't the principles of Evolution violate the principles of God?

The only reason you might object to anything in the Bible being used against your argument is that it's very effective against your argument and you'd prefer not to have your own book used to refute your own assertions.

That'll be the day.

 

[AV1611VET]

You obviously don't understand what the word "theory" means.

And you obviously don't understand what the word "day" means.

 

[JohnR7]

You're likely under this false impression because many churches don't tell their members about all of the evidences for evolution. I've had a few come to my door who stand speechless for several seconds when I hand them a list.

There is a lot of "evidence" for evolution. But it all still falls into two main groups. The evidence that has been falsifed and the evidence that has not yet been falsified. Far to often in practice evos do not make a distinction. They use the "evidence" if it has been falsifed or not. This makes some people angry when they come to realize that they have been lied to and given a lot of evidence that is simply not true. For every "evidence" you have there is a rebutal that will show your evidence does not support evolution. There is a whole lot of people out there that have doubts and they are waiting for that one peice of evidence that will show them one way or the other that evolution is true. Not that it would make all that much differenct to them in their lives. But just like in a who done it mystery,they would like to have the solution to the riddle of is evolution true or not. I think there is a lot of people who would like to know one way or the other. People who otherwise do not even care one way or the other if it's true or not.

 

[Beastt]

And you obviously don't understand what the word "day" means.

Genesis 1:5 "And God called the light Day and the darkness he called Night. And the evening and the morning were the first day."

Genesis 1:13 "And the evening and the morning were the third day."

Try reading it for yourself instead of letting people tell you what it means. People who tell you what it means have already decided it must be accurate and will adjust their explanation to fit what can be demonstrated as true no matter what the book actually says.

 

[AV1611VET]

The Theory of Evolution is the most credible of all suggested concepts to explain the diversity of life on this planet, and in becoming a "theory", has shown itself to comply with ALL of the available relevant evidence.

All except one: it leaves God out of the picture, and thus invalidates itself as a viable method of explaining the first six days of earth.

Speaking of that --- what DOES evolution say about the first 6 days of earth? What happened, say, on Day 4?

Incidentally, did you know the Earth existed before the Sun did?