Common Design and Phylogenies

[Loudmouth]

I would like a creationist who proposes that shared features are the result of common design to explain to us why common design would necessarily produced an objective phylogeny, otherwise known as a nested hierarchy.

For example, why would a common designer not be able to create a species with feathers and three middle ear bones? Why would a common designer not be able to produce a species with an exact copy of a jellyfish and mouse gene?

 

[Loudmouth]

Bumping for creationists who continue to claim that a nested hierarchy is predicted by common design.

 

[AV1611VET]

I would like a creationist who proposes that shared features are the result of common design to explain to us why common design would necessarily produced an objective phylogeny, otherwise known as a nested hierarchy.

God does the common designing.

Scientists create a false positive (link) between them ... that is, scientists nest them.

 

[Loudmouth]

God does the common designing.

Scientists create a false positive (link) between them ... that is, scientists nest them.

Then please tell us how the pattern of shared and derived features that we observe does not fit the predictions of the theory of evolution. If you can't, then you can hardly claim that the link is false.

 

[AV1611VET]

Then please tell us how the pattern of shared and derived features that we observe does not fit the predictions of the theory of evolution.

Who said they don't fit predictions?

Just because science can look and A and predict B, doesn't mean A and B are linked.

If you can't, then you can hardly claim that the link is false.

It's a false positive.

 

[Biologist]

Then please tell us how the pattern of shared and derived features that we observe does not fit the predictions of the theory of evolution. If you can't, then you can hardly claim that the link is false.

To common design creationists, any sequence no matter how paradoxical fits within the "common design" model. Viral DNA, deactivated genes and transposible elements were either present at creation or independently infected/mutated/transposed each population in exactly the same way.

If it was one big miracle or a trillion tiny ones it makes no difference to many creationists. They will never tie these phenomena to observable phenomena(ERVirus, mutation, Transposable Elements, heredity) because that would make the miracles testable.

 

[Subduction Zone]

To common design creationists, any sequence no matter how paradoxical fits within the "common design" model. Viral DNA, deactivated genes and transposible elements were either present at creation or independently infected/mutated/transposed each population in exactly the same way.

If it was one big miracle or a trillion tiny ones it makes no difference to many creationists. They will never tie these phenomena to observable phenomena because that would make the miracles testable.

That is because they have learned one lesson from their past. Testable creationist ideas always fail, so why use the scientific method?

 

[PsychoSarah]

Who said they don't fit predictions?

Just because science can look and A and predict B, doesn't mean A and B are linked.
It's a false positive.

The problem with claiming that it is a false positive, is that since there are none that don't fit evolution, any creator would have had to create the illusion of relatedness on purpose. In fact, it would have been hard to do it on purpose to. Given that so many DNA sequences have identical impacts on how an organism develops, there are no practical reasons for any living creature to seem related on a genetic level.

As you can see from this chart, there are only 2 sequences that do not have alternative ones that perform the same function out of 64 of them.
ATGATAGTTAAGGAGGGTTACACTTAA
ATGATCGTCAAAGAAGGGTATACATGA
The two above sequences are completely different, yet they code exactly the same. The only sequence they share is the start codon ATG, which all coding gene sequences start with. I bolded the bases which are different.

 

[AV1611VET]

The problem with claiming that it is a false positive, is that since there are none that don't fit evolution, any creator would have had to create the illusion of relatedness on purpose.

That sounds almost like a threat.

Either create something that doesn't fit our interpretation of evolution,* or we'll believe Darwin & Linnaeus.

* It must not show any ties to natural selection; it must not operate on the fight-or-flight response; and its DNA has to be unlike anything on record.

Do you know what I think would happen, Sarah, if God did that?

Scientists would probably just categorize it as some kind of stand-alone species (cryptid?) and get back to the business of denying instant creation.

Thanks to Linnaeus -- a born again Christian, as I understand him to be -- evolution flourishes.

I consider both Darwin & Linnaeus to be two of Satan's most cherished individuals he was able to get to.

Almost up there with Nimrod.

And although I believe all three are in Heaven now, they've been regretting their work for centuries.

 

[PsychoSarah]

That sounds almost like a threat.

Either create something that doesn't fit our interpretation of evolution,* or we'll believe Darwin & Linnaeus.

* It must not show any ties to natural selection; it must not operate on the fight-or-flight response; and its DNA has to be unlike anything on record.

Do you know what I think would happen, Sarah, if God did that?

Scientists would probably just categorize it as some kind of stand-alone species (cryptid?) and get back to the business of denying instant creation.

Thanks to Linnaeus -- a born again Christian, as I understand him to be -- evolution flourishes.

I consider both Darwin & Linnaeus to be two of Satan's most cherished individuals he was able to get to.

Almost up there with Nimrod.

And although I believe all three are in Heaven now, they've been regretting their work for centuries.

No, AV, it is literally easier to make every single living thing with DNA that doesn't hint at any relation, than it would be to keep track of every detail so closely, that the illusion of evolution could be attained. Not that the term "easier" means much to an omnipotent being, but you get the point from my previous post.

Furthermore, it makes you wonder why there are so many redundant DNA codons (the groups of three bases that code for a protein). Why use 64 if you only need 21 (or 23, as seen in some very uncommon cases)? Those remaining 43 repeats could have been used for even more variation.

 

[AV1611VET]

No, AV, it is literally easier to make every single living thing with DNA that doesn't hint at any relation,

Easier for who?

Was God obligated to create everything different, just so scientists in the future wouldn't lead people astray?

Is it fair for carpenters and metal workers to use templates and standard measurements for the sake of ease, while at the same time questioning why God didn't use non-standard templates and measurements?

God created Adam in His image & likeness and gave him DNA to insure mankind would keep that image & likeness.

 

[Biologist]

Thanks to Linnaeus -- a born again Christian, as I understand him to be -- evolution flourishes.

He was a biblical special creationist for his entire life.

 

[AV1611VET]

He was a biblical special creationist for his entire life.

He was special alright.

I won't say how.

 

[loveofourlord]

Lets not forget that the problem with same design same designer is that it doesn't show a good designer if your using that argument.

thats like if you used a ford truck to design a ford car, then all parts that were not needed are welded randomly to the frame of the car nearest the points they were in the truck.

it's what we see all the time with evolution and humans. It's not just the simularities, it's the history that shouldn't be there.

We don't just contain simular genes as other apes, we contain genes that other apes use, but we no longer use, we have genes for many scents other animals use, but we can't, same with Dolphins, that don't smell, but a good chunk of their genome is devoted to scent genes they don't use.

 

[PsychoSarah]

Easier for who?

Was God obligated to create everything different, just so scientists in the future wouldn't lead people astray?

Yes.

Is it fair for carpenters and metal workers to use templates and standard measurements for the sake of ease, while at the same time questioning why God didn't use non-standard templates and measurements?

Yes, because convenience is meaningless to a being often called omnipotent.

God created Adam in His image & likeness and gave him DNA to insure mankind would keep that image & likeness.

I wasn't suggesting not to use DNA at all, just that different species not have similarities in DNA. Especially not similarities in junk DNA.

 

[In situ]

God does the common designing.

Scientists create a false positive (link) between them ... that is, scientists nest them.

Please explain how this observation:

Leading to this organization:

Is a "false positive (link) between them".

The orgainzation is real and it exists as an objective observation. Yes you can rearrange the colors, but they are still there and they imply a nested hierarchy and that hierarchy in turn implies a common decent. Implication are facts, i.e. common decent is a fact.

 

[In situ]

Thanks to Linnaeus -- a born again Christian, as I understand him to be -- evolution flourishes.

So you do acknowledge that taxonomy is correctly done?

 

[In situ]

Just because science can look and A and predict B, doesn't mean A and B are linked.

A correlation is a correlation. You are not entitled to say it is not when it is. In particular there is a most real "link" between a parent and its offspring - a link you with this little word game now tries to deny exists.

It's a false positive.

Forensic science can predict who is related by whom just by looking at the genomes and see if they are nested or not. Confirming nesting is how family relations is determined in court cases.

Do you deny that fatherhood tests works?

To be more explicit; you have just claimed that heredity is a "false positive". Saying that implies the claim that inherent traits are not real but a fiction of the mind - a "false positive". If you really believe this is the case, then I don't know what else to say AV...

 

[In situ]

It's a false positive.

Thinking a little bit more on what you just written here. How convenient isn't it for you to just dismiss the fact that, says, humans share milk glands, hair, diversified teeth, three ear bones, a single lower jaw bone, give life birth, placenta and hundreds of other unique (nested) characteristics with all other mammals as just a coincident?

Why is this type of "coincidences" seen in all life, including the fossil record?

Why is the very same "coincidences" reoccurring and confirmed when independent methods are used, such as in phylogenetics, morphology, physiology, anatomy, genetics, etc etc?

Why is it possible to cross validate and confirm this "false positive" using different lines of evidence with independent methods over and over again, no matter where we look and what we look at?

Is it a "false positive" a mallard only looks like a duck or is it actually a duck?
Is it a "false positive" all ducks only looks like a duck or are they actually ducks?
Is it a "false positive" all ducks only looks like a bird or are they actually birds?
Is it a "false positive" all birds only looks like a dinosaur or are they actually dinosaurs?
Is it a "false positive" all dinosaurs only looks like an amniote or are they actually amniotes?
Is it a "false positive" all amniotes only looks like a tetrapod or are they actually tetrapods?
Is it a "false positive" all tetrapods only looks like a vertebrate or are they actually vertebrates?
Is it a "false positive" all vertebrates only looks like an animal or are they actually animals?
Is it a "false positive" all animals only looks like an eucaryote or are they actually eucaryotes?

('only looks like' in the sense of 'looks like nothing else except')

Can it be that this "coincident" actually is a real thing? Put in other words, how much evidence do you actually demand before you accept it is not a coincident? Oh, I forgot, by your own statements; whenever evidence contradicts your beliefs then it does not count as evidence any more - because then it is "coincidences". So intellectually honest of you.... at least you should be able to admit (if only to yourself) that you believe in a deceptive creator or that your creator has concealed his creation very well for most of us to be able to see his hand in all of it.

 

[Loudmouth]

Who said they don't fit predictions?

Just because science can look and A and predict B, doesn't mean A and B are linked.
It's a false positive.

How would the evidence need to be different for a true positive?