• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

repost: the urate oxidase pseudogene

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
i've already posted this argument on here before, but I don't recall ever getting a decent answer, so I'll post it again. (I also posted it on infidels, as yet there hasn't been any answer)

copied straight from infidels:

The following evidence I feel amply demonstrates the common ancestry (and not "common design") of chimpanzees and human beings and why DNA homology is excellent evidence for evolution

the following is a multiple alignment of the sequences of human, chimp, orangutan and owl monkey urate oxidase sequences. The premature stop codon is in bold and italics.

Human Urate Oxidase Psuedogene CDS (exons 1-8)
http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20513570&do pt=GenBank (see the end of the post for corroboration)

Orangutan Urate Oxidase pseudogene CDS (exons 1-8)
http://www.ncbi.nlm.nih.gov:80/entr...db=nucleotide&list_uids=20513597&dopt=GenBank

Chimpanzee Urate Oxidase Pseudogene CDS (exons 1 -8)
http://www.ncbi.nlm.nih.gov:80/entr...db=nucleotide&list_uids=20513579&dopt=GenBank

Spider Monkey Urate Oxidase (exons 1-8)
http://www.ncbi.nlm.nih.gov:80/entr...db=nucleotide&list_uids=20513645&dopt=GenBank



code:


Code:
CLUSTAL X (1.81) multiple sequence alignment




human           ATGGCCCACTACCATAACAACTATAAAAAGAATGATGAGGTGGAGTTTGTCCGAACTGGC
chimpanzee      ATGGCCCACTACCATAACAACTATAAAAAGAATGATGAGGTGGAGTTTGTCCGAACTGGC
orangutan       ATGGCCCACTACCGTAACAACTATAAAAAGAATGATGAGGTGGAGTTTGTCCGAACTGGC
owlmonkey       ATGGCCCACTACCATAACGACTATAAAAAGAACGATGAGGTGGAGTTTGTACGAACTGGC
                ************* **** ************* ***************** *********

human           TATGGGAAGGAAATGGTAAAAGTTCTCCATATTCAG[b][color=red]T[/color]GA[/b]GATGGAAAATATCACAGCATT
chimpanzee      TATGGGAAGGATATGGTAAAAGTTCTCCATATTCAG[b][color=red]T[/color]GA[/b]GATGGAAAATATCACAGCATT
orangutan       TATGGGAAGGATATGGTAAAAGTTCTCCATATTCAG[b][color=red]T[/color]GA[/b]GATGGAAAATATCACAGCATT
owlmonkey       TATGGGAAGGATATGGTAAAAGTCCTCCATATTCAG[b]CGA[/b]GATGGAAAATATCACAGCATT
                *********** *********** ************ ***********************

human           AAAGAGGTGGCAACTTCAGTGCAACTTACTCTAAGTTCCAAAAAAGATTACCTGCATGGA
chimpanzee      AAAGAGGTGGCAACTTCAGTGCAACTTACTCTAAGTTCCAAAAAAGATTACCTGCATGGA
orangutan       AAAGAGGTGGCAACTTCAGTGCAACTTACTCTGAGTTCCAAAAAAGATTACCTGCATGGA
owlmonkey       AAAGAGGTGGCAACTTCAGTGCAACTTACTCTGAGTTCCAAAAAAGATTACCTGCATGGA
                ******************************** ***************************

human           GATAATTCAGACATCATCCCTACAGACACCATCAAGAACACAGTTCATGTCTTGGCAAAG
chimpanzee      GATAATTCAGACATCATCCCTACAGACACCATCAAGAACACAGTTCATGTCTTGGCAAAG
orangutan       GATAATTCAGACATCATCCCTACAGACACCATCAAGAACACAGTTCATGTCTTGGCAAAG
owlmonkey       GACAATTCAGATATCATCCCTACAGACACCATCAAGAACACAGTTCATGCCTTGGCAAAG
                ** ******** ************************************* **********

human           TTTAAAGAAATCAAAAGCATAGAAGCCTTTGGTGTGAATATTTGTGAGCATTTTCTTTCT
chimpanzee      TTTAAAGAAATCAAAAGCATAGAAGCCTTTGGTGTGAATATTTGTGAGCATTTTCTTTCT
orangutan       TTTAAAGGAATCAAAAGCATAGAAGCCTTTGGTGTGAATATTTGTGAGCATTTTCTTTCT
owlmonkey       TTTAAAGGAATCAAAAGCATAGAAGCCTTTGCTGTGAATATTTGTCAGCATTTTCTTTCT
                ******* *********************** ************* **************

human           TCTTTTAACCATGTAATCCGAGCTCAAGTCTACATGGAAGAAATCCCTTGGAAGCATCTT
chimpanzee      TCTTTTAACCATGTAATCCGAGCTCAAGTCTATGTGGAAGAAATCCCTTGGAAGCATCTT
orangutan       TCTTTTAACCATGTAATCTGAGCTCAAGTCTACGTGGAAGAAATTCCTTGGAAGCATCTT
owlmonkey       TCTTTTAACCATGTCATCCGAACTCAAGTCTATGTGGAAGAAATCCCTTGGAAGCGGCTT
                ************** *** ** **********  ********** **********  ***

human           GGAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGGAACACACTTC
chimpanzee      GAAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGGAACACACTTC
orangutan       GAAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGGAACACACTTC
owlmonkey       GAAAAGAATGGAGTTAAGCATGTCCATGCATTTATTCACACTCCCACTGGAACACACTTC
                * **********************************************************

human           TGTGAAGTTGAACAGCTGAGAAGTGGACCCCAAGTCATTCATTCTGGAATCAAAGACCTC
chimpanzee      GGTGAAGTTGAACAGCTGAGAAGTGGACCCCAAGTCATTCATTCTGGAATCAAAGACCTC
orangutan       TGTGAAGTTGAACAGCTGAGAAGTGGACCCCCAGTCATTCATTCTGGAATCAAAGACCTC
owlmonkey       TGTGA-GTTGAACAGCTGAGAAGTGGACCCCCAGTTATTCATTCTGGAATCAAAGACCTC
                 **** ************************* *** ************************

human           AAGGTCTTGAAAACAACACAGTCTGGATTTGAAGGTTTCATCAAGGACCAGTTCACTACC
chimpanzee      AAGCTCTTGAAAACAACACAGTCTGGATTTGAAGGTTTCATCAAGGACCAGTTCACTACC
orangutan       AAGGTCTTGAAAACAACATAGTCTCGATGTGACGGTTTCATCAAGGACCAGTTCACTACC
owlmonkey       AAGGTCTTGAAAACAACCCAGTCTGGATTTGAAGGTTTCATCAAGGACCAGTTCACCACC
                *** *************  ***** *** *** *********************** ***

human           CTCCCTGAGGTGAAGGACTGATGCTTTGCCACCCAAGTGTACTGCAAGTGGCGCTACCAC
chimpanzee      CTCCCTGAGGTGAAGGACTGATGCTTTGCCACCCAAGTGTACTGCAAGTGACGCTACCAC
orangutan       CTCCCTGAGGTGAAGGACCGATGCTTTGCCACCCAAGTGTACTGCAAGTGGCGCTACCAC
owlmonkey       CTCCCTGAGGTGAAGGACCGATGCTTTGCCGCACAAGTATACTGCAAGTGGCGCTACCAC
                ****************** *********** * ***** *********** *********

human           CAGTGCAGGGATGTGGACTTCAAGGCTACCTGGGACACCATTCGGGACCTTGTCATGGAG
chimpanzee      CAGTGCAGGGATGTGGACTTCAAGGCTACCTGGGACACCATTCGGGACCTTGTCATGGAG
orangutan       CAGTGCAGGGATGTGGACTTCGAGGCTACCTGGGACACCATTTGGGACCTTGTCCTGGAG
owlmonkey       CAGTGCAGGGATGTGGACTTCGAGGCTACCTGGGACACCATTCGGGACGTTGTCCTAGAG
                ********************* ******************** ***** ***** * ***

human           AAATCTGCTGGGCCCTATGACAAAGGTGAATACTTGACCTCTGTGCAGAAGACCCTCTGT
chimpanzee      AAATCTGCTGGGCCCTATGACAAAGATGAATACTCGCCCTCTGTGCAGAAGACCCTCTGT
orangutan       AAATCTGCTGGGCCNTATGACAAAGGCGAATACTTGCCCTCTGTGCAGAAGACCCTCTAT
owlmonkey       AAATTTGCTGGGCCCTATGACAAAGGCGAGTACTCGCCGTCTGTGCAGAAGACCCTCTAT
                **** ********* **********  ** **** * * ******************* *

human           GATATCCAGGTGCTCTCCCTGAGCCGAGTTCCTGCGATAGAAGATATGGAAATCAGCCTG
chimpanzee      GATATCCAGGTGCTCTCCCTGAGCCGAGTTCCTGCGATAGAAGATATGGAAATCAGCCTG
orangutan       GATATCCAGGTGCTCTCCCTGTGCCGAGTTCCTGAGATAGAAGATATGGAAATCAGCCTG
owlmonkey       GATATCCAGGTGGTCTCCCTGAGTCAAGTCCCTGAGATAGACGATATGGAAATCAGCCTG
                ************ ******** * * *** **** ****** ******************

human           CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAACAAGGAAGAG
chimpanzee      CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAACAAGGAAGAG
orangutan       CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAACAAGGAAGAG
owlmonkey       CCAAACATTCACTACTTCAACATAGACATGTCCAAAATGGGTCTGATCAACAAGGAAGAG
                ************************************************************

human           GTCTTGCTGCCATTAGACAATCCATATGGAAAAATTACTGGTACAGTCAAGAGGAAGTTG
chimpanzee      GTCTTGCTGCCATTAGACAATCCATATGGAAAAATTACTGGTACAGTCAAGAGGAAGTTG
orangutan       GTCTTGCTGCCATTAGACAATCCATATGGAGAAATTACTGGTACAGTCAAGAGGAAGTTG
owlmonkey       GTCTTGCTGCCATTAGACAATCCATATGGCAAAATTACTGGTACAGTCAAGAGGAAGTTG
                *****************************  *****************************

human           TCTTCAAGACTGTGA
chimpanzee      TCTTCAAGACTGTGA
orangutan       TCTTCAAGACTGTGA
owlmonkey       TCTTCGAGACTGTGA
                ***** *********


*'s represent nucleotides that are identical. Spaces indicate differences.

Human Urate Oxidase Pseudogene translated:

Met A H Y H N N Y K K N D E V E F V R T G Y G K E Met V K V L H I Q Stop D G K Y H S I K E V A T S V Q L T L S S K K D Y L H G D N S D I I P T D T I K N T V H V L A K F K E I K S I E A F G V N I C E H F L S S F N H V I R A Q V Y Met E E I P W K H L G K N G V K H V H A F I H T P T G T H F C E V E Q L R S G P Q V I H S G I K D L K V L K T T Q S G F E G F I K D Q F T T L P E V K D Stop C F A T Q V Y C K W R Y H Q C R D V D F K A T W D T I R D L V Met E K S A G P Y D K G E Y L T S V Q K T L C D I Q V L S L S R V P A I E D Met E I S L P N I H Y F N I D Met S K Met G L I N K E E V L L P L D N P Y G K I T G T V K R K L S S R L Stop


Notice the translated sequence of the pseudogene has several "premature stop codons"
A premature stop codon is one that appears in the middle of a gene, rather than at the end. What this effectively does is truncate the protein - it is no longer translated to the end.

i.e. instead of getting the entire sequence translated, what you get instead is

Met A H Y H N N Y K K N D E V E F V R T G Y G K E Met V K V L H I Q Stop

This renders the gene non-functional. It is severely truncated, it is missing its C- terminal signal peptide which targets it to peroxisome, where it would usually function. Its also missing about 90 percent of the original protein. The premature stop codon occurs in the same place in humans, gorillas, chimpanzees and orangutans

A fully functional copy of urate oxidase

http://www.ncbi.nlm.nih.gov:80/entrez/query.fcgi?cmd=Retrieve&db=nucleotide&list_uids=20513645&do pt=GenBank

Aotus trivirgatus (owl monkey) urate oxidase gene:

atggcccact accataacga ctataaaaag aacgatgagg tggagtttgt acgaactggc tatgggaagg atatggtaaa agtcctccat attcagcgag atggaaaata tcacagcatt aaagaggtgg caacttcagt gcaacttact ctgagttcca aaaaagatta cctgcatgga gacaattcag atatcatccc tacagacacc atcaagaaca cagttcatgc cttggcaaag tttaaagga atcaaaagca tagaagcctt tgctgtgaat atttgtcagc attttctttc ttcttttaac catgtcatcc gaactcaagt ctatgtggaa gaaatccctt ggaagcggct tgaaaag aatggagtta agcatgtcca tgcatttatt cacactccca ctggaacaca cttctgtga gttgaacagc tgagaagt ggacccccag ttattcattc tggaatcaaa gacctcaagg tcttgaaaac aacccagtct ggatttgaag gtttcatcaa ggaccagttc accaccctcc ctgaggtgaa ggaccgatgc tttgccgcac aagtatactg caagtggcgc taccaccagt gcagggatgt ggacttcgag gctacctgg gacaccattc gggacgttgt cctagagaaa tttgctgggc cctatgacaa aggcgagtac tcgccgtctg tgcagaagac cctctatgat atccaggtgg tctccctgag tcaagtccct gagatagacgata tggaaatcag cctgccaaac attcactact tcaacataga catgtccaaa atgggtctga tcaacaagga agaggtcttgctgc cattagacaa tccatatggc aaaattactg gtacagtcaa gaggaagttg tcttcgagac tgtga

Translation:

Met A H Y H N D Y K K N D E V E F V R T G Y G K D Met V K V L H I Q R D G K Y H S I K E V A T S V Q L T L S S K K D Y L H G D N S D I I P T D T I K N T V H A L A K F K G I K S I E A F A V N I C Q H F L S S F N H V I R T Q V Y V E E I P W K R L E K N G V K H V H A F I H T P T G T H F C E V E Q L R S G P P V I H S G I K D L K V L K T T Q S G F E G F I K D Q F T T L P E V K D R C F A A Q V Y C K W R Y H Q C R D V D F E A T W D T I R D V V L E K F A G P Y D K G E Y S P S V Q K T L Y D I Q V V S L S Q V P E I D D Met E I S L P N I H Y F N I D Met S K Met G L I N K E E V L L P L D N P Y G K I T G T V K R K L S S R L Stop

Blast pairwise alignments:

human/owl monkey:

Score = 1483 bits (771), Expect = 0.0
Identities = 867/915 (94%)
Strand = Plus / Plus

As you can no doubt see, this functional copy has only one stop codon, at the end of the protein. It is also 94 percent homologous to the pseudogenes in humans.

some additional information:

Function of urate oxidase:

http://www.biochem.missouri.edu/ptipton_urate.html

Nonsense mediated Decay:

http://www.ncbi.nlm.nih.gov/Coffeebreak/CB7_NMD/page.html

(23):9412-6
 

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
Hypertension 2002 Sep;40(3):355-60
Related Articles, Links


Uric acid, hominoid evolution, and the pathogenesis of salt-sensitivity.

Watanabe S, Kang DH, Feng L, Nakagawa T, Kanellis J, Lan H, Mazzali M, Johnson RJ.

Division of Nephrology, Baylor College of Medicine, Houston, Tex 77030, USA.

Humans have elevated serum uric acid as a result of a mutation in the urate oxidase (uricase) gene that occurred during the Miocene. We hypothesize that the mutation provided a survival advantage because of the ability of hyperuricemia to maintain blood pressure under low-salt dietary conditions, such as prevailed during that period. Mild hyperuricemia in rats acutely increases blood pressure by a renin-dependent mechanism that is most manifest under low-salt dietary conditions. Chronic hyperuricemia also causes salt sensitivity, in part by inducing preglomerular vascular disease. The vascular disease is mediated in part by uric acid-induced smooth muscle cell proliferation with activation of mitogen-activated protein kinases and stimulation of cyclooxygenase-2 and platelet- derived growth factor. Although it provided a survival advantage to early hominoids, hyperuricemia may have a major role in the current cardiovascular disease epidemic.

PMID: 12215479 [PubMed - indexed for MEDLINE]




: Semin Hematol 2001 Oct;38(4 Suppl 10):13-21
Related Articles, Links


Urate oxidase in the prophylaxis or treatment of hyperuricemia: the United States experience.

Pui CH.

St. Jude Children's Research Hospital, and Department of Pediatrics, University of Tennessee, College of Medicine, Memphis, TN 38105, USA.

Nonrecombinant urate oxidase (Uricozyme, Sanofi-Synthelabo, Inc, Paris, France) is a highly effective uricolytic agent, but its use is associated with hypersensitivity reaction manifested mainly by bronchospasm in approximately 5% of patients. Recently, several multi-institutional studies have evaluated the efficacy and safety of a recombinant urate oxidase (rasburicase). In a phase I/II study, all 131 patients with newly diagnosed acute lymphoblastic leukemia (ALL) or stage III/IV non-Hodgkin's lymphoma (NHL) experienced rapidly decreased plasma uric acid concentrations after receiving recombinant urate oxidase. Serum creatinine levels also decreased significantly. Toxicity was negligible, and none of the patients required dialysis. In a phase III trial, children with newly diagnosed ALL or stage III/IV NHL were stratified and randomized to receive recombinant urate oxidase or allopurinol. Results showed that the 27 patients who received recombinant urate oxidase had a significantly lower plasma uric acid concentration and a more rapid decline in serum creatinine level than did the 25 who took allopurinol. One patient in the recombinant urate oxidase group had hemolysis of unknown cause, and one in the allopurinol group required hemofiltration for hyperphosphatemia. To further assess the safety profile of recombinant urate oxidase, the data on 245 patients (173 children and 72 adults) who received this agent in a compassionate- use program were reviewed retrospectively. The drug produced dramatic decreases in uric acid concentrations in all patients. Nine patients (four children and five adults) had mild adverse reactions that were drug-related or of unknown etiology. These data suggest that recombinant urate oxidase is safe and effective in the prophylaxis and treatment of hyperuricemia associated with malignancy or chemotherapy. Copyright 2001 by W.B. Saunders Company.

PMID: 11694947 [PubMed - indexed for MEDLINE]


So, what we have is homologous DNA in humans and chimps which has no function. The "Common design" hypothesis states that DNA homology is due not to evolutionary relationships but due to similar function. This DNA has no function, so why is it homologous?

If you want anything explained, just ask




References:
Oda M, Satta Y, Takenaka O, Takahata N. Loss of urate oxidase activity in hominoids and its evolutionary implications. Mol Biol Evol 2002 May;19(5):640-53


Yeldandi AV, Patel YD, Liao M, Kao FT, Rao MS, Reddy JK, Le Beau MM. Localization of the human urate oxidase
gene (UOX) to 1p22.Cytogenet Cell Genet 1992;61(2):121-2

Wu XW, Lee CC, Muzny DM, Caskey CT. Urate oxidase: primary structure and evolutionary implications. Proc Natl Acad Sci U S A 1989 Dec;86(23):9412-6
 
Upvote 0

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
because it's a non-working version of a gene to which it is 94 percent similar

we know it doesn't work because it has a premature stop codon which truncates it severely and possibly makes it subject to nonsense-mediated decay. So not only would the final protein product be non-functional - it most likely never even gets translated to a final protein product
 
Upvote 0

Christian Soldier

QUESTION EVOLUTION
Aug 1, 2002
1,524
55
Visit site
✟2,190.00
Faith
Baptist
Marital Status
Single
Politics
US-Constitution
"Pseudogenes look like normal genes but do not express any RNA or protein. They include supposedly crippled copies of known functional genes, LINEs (long interspersed repeats) and SINEs (short interspersed repeats).1,2 But in the article on pp. 55–71 [of CENTJ 14(3)], Woodmorappe shows how testable and repeatable science is displacing the evolutionary concept that pseudogenes are non-functional and that they can be used in establishing primate phylogenies.1 Some highlights are presented here.

Pseudogenes are often referred to in the scientific literature as non-functional DNA, and are regarded as junk. But more scientists are now conceding that this is far from true for many pseudogenes. Failure to observe pseudogenes coding for a product under experimental conditions is no proof that they never do so inside an organism. It is also impossible to rule out protein expression based solely on sequence information, as DNA messages can be altered by, e.g. editing the transcribed RNA, skipping parts of the sequence, etc. Moreover, the inability to code for a protein useful to an organism hardly exhausts other possible functions pseudogenes may have (see below).

Furthermore, there is a growing body of evidence that Alu (a SINE) sequences are involved in gene regulation, such as in enhancing and silencing gene activity, or can act as a receptor-binding site — this is surely a precedent for the functionality of other types of pseudogenes. Future studies on the one million Alu copies scattered in the human genome should reveal further regulatory functions of these elements.

The persistence of pseudogenes is in itself additional evidence for their activity. This is a serious problem for evolution, as it is expected that natural selection would remove this type of DNA if it were useless, since DNA manufactured by the cell is energetically costly. Because of the lack of selective pressure on this neutral DNA, one would also expect that ‘old’ pseudogenes should be scrambled beyond recognition as a result of accumulated random mutations. Moreover, a removal mechanism for neutral DNA is now known.

Pseudogenes and alleged primate evolution

Evolutionists have used the finding of similar pseudogenes in various members of the primate order as evidence for human common ancestry with apes. There are major contradictions, however, between molecular and morphological phylogenies; and as Woodmorappe shows, DNA sequence similarities between pseudogenes do not create self-evident truths, but need to be interpreted. For example, they cannot tell us anything about their common ancestors, even if such indeed existed.

A closer look at the pseudogene DNA sequence data that supposedly supports the primate evolutionary tree reveals some major inconsistencies:

A large fraction of most pseudogenes differ considerably from their alleged parent genes which makes the interpretation of the data questionable.

Although some pseudogenes such as LINEs and Alus appear to be hierarchically shared between primates, others clearly are not. An example of such a discordancy is the sharing of SINE elements between evolutionarily more-distant organisms to the exclusion of animals of intermediate evolutionary derivation, despite the presence of intact homologous genetic loci in the latter.

Pseudogene sequences are frequently exchanged. This complicates any interpretation of phylogeny.

One evolutionary tenet is that pseudogenes such as SINEs and LINEs insert randomly. The independent insertion of such sequences in the genomes of two clearly unrelated animals should therefore be virtually impossible. So the presence of identical sequences at homologous sites in the genomes of two organisms unquestionably indicates common ancestry. However, the independent acquisition of both LINE and SINE elements at the exact site in different animals has now been demonstrated. Moreover, it has now been shown that these elements have insertion hotspots at specific DNA sequences, and at chromosomal cleavage/break sites in bent or coiled DNA.

Conclusion

As the function of more pseudogenes is being uncovered by testable and repeatable science, it is evident that these genetic elements, which are copiously spread in the genomes of different organisms, have been created with purpose. The recent finding of insertion hotspots also clarifies how pseudogenes may have appeared to evolutionists as shared mistakes and now invalidates their use in phylogenetic studies.

References

1. Woodmorappe, J., Are pseudogenes ‘shared’ mistakes between primate genomes? CEN Tech. J. 14(3): 55–71, 2000. Return to text.

2. Walkup, L.K., Junk DNA, CEN Tech. J. 14(2):18–30, 2000. Return to text."

http://www.answersingenesis.org/home/area/magazines/tj/docs/tjv14n3pseudogene_pj.asp

--------------------------------------------------------------------------------

For a more in-depth critique of evolutionist misconceptions and misrepresentations regarding pseudogenes, go here:

http://www.answersingenesis.org/Home/Area/Magazines/tj/docs/tj14_3-jw_pseudo.pdf
 
Upvote 0

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
thats not discussion christian soldier, thats posting someone elses arguments against pseudogenes in general, no mention of how it applies to this particular pseudogene - i'll actually go to the trouble of explaining why your quotations don't apply, in the hope that you'll actually discuss the evidence, rather than trawl your favourite sites for a generic argument that has no relevance to the evidence supplied

"Pseudogenes look like normal genes but do not express any RNA or protein. They include supposedly crippled copies of known functional genes, LINEs (long interspersed repeats) and SINEs (short interspersed repeats).1,2 But in the article on pp. 55–71 [of CENTJ 14(3)], Woodmorappe shows how testable and repeatable science is displacing the evolutionary concept that pseudogenes are non-functional and that they can be used in establishing primate phylogenies.1 Some highlights are presented here

this gene isn't supposedly crippled, its actually crippled, it does not function as urate oxidase anymore

Pseudogenes are often referred to in the scientific literature as non-functional DNA, and are regarded as junk. But more scientists are now conceding that this is far from true for many pseudogenes. Failure to observe pseudogenes coding for a product under experimental conditions is no proof that they never do so inside an organism. It is also impossible to rule out protein expression based solely on sequence information, as DNA messages can be altered by, e.g. editing the transcribed RNA, skipping parts of the sequence, etc. Moreover, the inability to code for a protein useful to an organism hardly exhausts other possible functions pseudogenes may have (see below).

more scientists? who?

humans don't have a functional urate oxidase, otherwise leukemia patients wouldn't need to be given synthetic urate oxidase drugs. The urate oxidase pseudogenes also have broken promoters in addition to their premature stop codons - it doesn't get transcribed

Furthermore, there is a growing body of evidence that Alu (a SINE) sequences are involved in gene regulation, such as in enhancing and silencing gene activity, or can act as a receptor-binding site — this is surely a precedent for the functionality of other types of pseudogenes. Future studies on the one million Alu copies scattered in the human genome should reveal further regulatory functions of these elements.

the urate oxidase pseudogene is not an alu sequence, so this is irrelevant

The persistence of pseudogenes is in itself additional evidence for their activity. This is a serious problem for evolution, as it is expected that natural selection would remove this type of DNA if it were useless, since DNA manufactured by the cell is energetically costly. Because of the lack of selective pressure on this neutral DNA, one would also expect that ‘old’ pseudogenes should be scrambled beyond recognition as a result of accumulated random mutations. Moreover, a removal mechanism for neutral DNA is now known.

it isn't a serious problem for evolution at all, the persistence of redundant sequences is entirely consistent with neutral theory

old pseudogenes should be scrambled beyond all recognition? no, because these are neutral sequences, new mutations should be fixed at a rate of approximately 4Ne, and mutations arise at a rate of approximately 1x10^-9 mutations per site per generation - scrambling beyond recognition is not to be expected - especially considering the urate oxidase pseudogene has occured quite recently in evolutionary history

Evolutionists have used the finding of similar pseudogenes in various members of the primate order as evidence for human common ancestry with apes. There are major contradictions, however, between molecular and morphological phylogenies; and as Woodmorappe shows, DNA sequence similarities between pseudogenes do not create self-evident truths, but need to be interpreted. For example, they cannot tell us anything about their common ancestors, even if such indeed existed.
A closer look at the pseudogene DNA sequence data that supposedly supports the primate evolutionary tree reveals some major inconsistencies:

the urate oxidase sequences give a phylogenetic tree entirely consistent with the accepted phylogeny based on morphological characters - the hominidae are monophyletic, the gibbons are monophyletic and the new world monkeys are monophyletic

For example, they cannot tell us anything about their common ancestors, even if such indeed existed.

they can tell us that the common ancestor had a broken urate oxidase pseudogene.

A large fraction of most pseudogenes differ considerably from their alleged parent genes which makes the interpretation of the data questionable.

oops. was the word parent used? surely if these sequences aren't due to common ancestry, they cannot have a "parent" gene
unfortunately for you CS, this particular pseudogene is 94 percent homologous to a representative of its parent gene in spider monkeys

Although some pseudogenes such as LINEs and Alus appear to be hierarchically shared between primates, others clearly are not. An example of such a discordancy is the sharing of SINE elements between evolutionarily more-distant organisms to the exclusion of animals of intermediate evolutionary derivation, despite the presence of intact homologous genetic loci in the latter.

lines and sines have nothing to do with this evidence

Pseudogene sequences are frequently exchanged. This complicates any interpretation of phylogeny.

oh boy, they're really clutching at straws now, i'd love to see an example of horizontal transfer between primates

As the function of more pseudogenes is being uncovered by testable and repeatable science

as the functions of more pseudogenes are being uncovered? how about the function of any pseudogenes - can they actually provide any evidence for this absurd claim?

it is evident that these genetic elements, which are copiously spread in the genomes of different organisms, have been created with purpose.

?
please christian soldier, find a purpose for a broken urate oxidase pseudogene ("it takes up space in the genome" is not a valid purpose)

The recent finding of insertion hotspots also clarifies how pseudogenes may have appeared to evolutionists as shared mistakes and now invalidates their use in phylogenetic studies.

AIG is off with the fairies, the urate oxidase pseudogene has been a very reliable phylogenetic marker - read the paper in the references:

Oda M, Satta Y, Takenaka O, Takahata N. Loss of urate oxidase activity in hominoids and its evolutionary implications. Mol Biol Evol 2002 May;19(5):640-53
 
Upvote 0

Christian Soldier

QUESTION EVOLUTION
Aug 1, 2002
1,524
55
Visit site
✟2,190.00
Faith
Baptist
Marital Status
Single
Politics
US-Constitution
"The persistence of pseudogenes is in itself additional evidence for their activity. This is a serious problem for evolution, as it is expected that natural selection would remove this type of DNA if it were useless, since DNA manufactured by the cell is energetically costly. Because of the lack of selective pressure on this neutral DNA, one would also expect that ‘old’ pseudogenes should be scrambled beyond recognition as a result of accumulated random mutations. Moreover, a removal mechanism for neutral DNA is now known."

Bingo!
 
Upvote 0

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
I've already explained to you that the persistence of neutal DNA is expected because of neutral theory, it isn't a problem for evolution at all, and you have yet to actually explain why the urate oxidase pseudogene is present in chimps, gorillas, orangutans and humans - the genus hominidae

or why the urate oxidase sequences give an accurate phylogenetic tree
 
Upvote 0

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
haha, thanks for the link, the "removal mechanism" for neutral DNA the article refers to are deletion mutations, which are indiscriminate mechanisms for removing all DNA - they don't selectivley remove neutral DNA. It means that in order for a pseudogene to be removed - it has be removed by a specific random deletion mutation (it has to be the right sized deletion too, because the urate oxidase pseudogene is flanked by functional genes) in enough members of the species that it reaches fixation - thats almost as unlikely as three mutations producing the same stop codon in three closely related species independently.

all the articles which refer to the possible functions of junk DNA talk about either a structural role or its role in regulating the size of the nucleus - that depends on the amount of DNA, independently of the sequence of the DNA - so you still have the problem of explaining why the urate oxidase pseudogene sequences are homologous
 
Upvote 0

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
if anyone wants a laugh, check reference 24 of the pdf file

I didn't know you were allowed to reference articles which hadn't been written yet.

Now that I do, theres no stopping me;

Contrary to creationists protestations The theory of evolution has been proven conclusively1.

1)One of the authors of this paper will be Dr Fred Doesnotexist, who is a prominent scientist working in the field of evolutionary biology.
 
Upvote 0

chickenman

evil unamerican
May 8, 2002
1,376
7
44
Visit site
✟32,374.00
neutral theory says that most mutations are selectively neutral, and thus are governed more by random genetic drift than natural selection

so mutations that have negligible effects on survival are subject to random forces of sampling error.

It doesn't contradict darwin really, it just places less emphasis on selection as the force responsible for every nucleotide difference between the species. Its widely accepted as a major force in evolution (there are a few dissenters)
 
Upvote 0

MSBS

Well-Known Member
Jul 29, 2002
1,860
103
California
✟25,591.00
Gender
Male
Faith
Agnostic
Marital Status
Single
Politics
US-Libertarian
Originally posted by sulphur
I am not really into genetics but I am reading Professor Goulds last book and he mentions the work done by KIMURA on neutral substitutions as a case against Darwins theories at that level. Is this true?

Not really.  This is actually on argument about some aspects of neo-Darwinian theory.  Some would say that mutation creates variation and the natural selection allways takes over-- neutralists say that sometimes the variation provides no selective advantage or disadvantage and thus will not be selected for, it's neutral so far as the organisms are concerned.  This argument can get highly technical and go all the way to the molecular level, with highly charged debates going on about the effects of competition for tRNAs, etc.  It's an argument about details of the theory, not about the theory itself.
 
Upvote 0