Can Creationism Interpret Evidence?

[SkyWriting]

Not a peer reviewed journal.
A review paper is not original research.
Not a peer reviewed journal.
Want to try again?

I don't understand your point. You requested that
the research be published by Creationists.

Loudmouth said: ↑
You will notice that creationists do not publish research that
challenges the status quo. That's because they have no
science to present.

 

[Queller]

Show me where I made the claim Nobel Prizes were awarded for showing the Milky-Way was the entire universe?????? Go ahead show us??? I think your adding and putting words in my mouth in your pathetic strawman. Let's see what I said, find that post and post it here. I think you'll find it says nothing of the sort - just a strawman by you.

Right here: "Scientists once got Nobel prizes for discovering the milky-Way was the entire universe. How'd that turn out - despite the fact that all the scientists agreed it was well deserved????"

Bump for justatruthseeker

 

[Loudmouth]

I don't understand your point. You requested that
the research be published by Creationists.

And by publish, I mean publish in a peer reviewed journal. That's what that phrase means in scientific conversations.

 

[SkyWriting]

And by publish, I mean publish in a peer reviewed journal. That's what that phrase means in scientific conversations.

Such journals publish research that backed by investigations or experiments.
How would we identify the religious belief of a scientist who believes God
was the Creator? I wasn't aware that disclosure was required.

Lets check:
http://www.ncbi.nlm.nih.gov/pmc/?term=god+prayer

No, I can't find any such identifiers.
The lack of such knowledge is therefore
not evidence that they are not there.

 

[Loudmouth]

Such journals publish research that backed by investigations or experiments.
How would we identify the religious belief of a scientist who believes God
was the Creator? I wasn't aware that disclosure was required.

I asked for creationists, not Christians. You do know the difference, do you not?

Every peer reviewed paper has a section where the authors discuss their results and make their conclusions. Are you telling me that you can't find a single paper where the authors conclude that the evidence points to separate creation? They all conclude that species evolved from a common ancestor?

 

[whois]

Let's focus on three species: human (H. sapiens), mouse (M. musculus), and chicken (G. gallus). Let's also use the DNA comparison to negate the effect of synonymous mutations in the protein sequence.

The similarity between the human and mouse gene is 90.5%. The similarity between the human and chicken gene is 81.6%.

Now comes the hard part. What does creationism predict will be the difference between the chicken and mouse cycs gene sequence, and why?

my question to all of this is "how can you make any prediction at all with such things as HGT, gene mutation, and base pair insertions?"
these things would make predictions almost impossible.

 

[whois]

I asked for creationists, not Christians. You do know the difference, do you not?

Every peer reviewed paper has a section where the authors discuss their results and make their conclusions. Are you telling me that you can't find a single paper where the authors conclude that the evidence points to separate creation? They all conclude that species evolved from a common ancestor?

of course they conclude that.
hypothesis are often reworded to specifically exclude anything creationists can use.

yes, they conclude, and i agree, that common ancestry is the most logical answer, but the empirical evidence for this belief is lacking.

 

[sfs]

my question to all of this is "how can you make any prediction at all with such things as HGT, gene mutation, and base pair insertions?"
these things would make predictions almost impossible.

And yet we are able to make this kind of prediction quite easily, and they turn out to be correct in the overwhelming majority of cases. Perhaps you should refine your understanding of the effects of HGT, gene mutation and base pair insertions. As you have been told many times, HGT is so rare in vertebrates that it can usually be ignored. Do you not understand that, or not believe it, or what?

The other parts of your question are more puzzling. Gene mutation is precisely the basis of Loudmouth's ability to predict genetic similarity: the genetic divergence he's talking about is the result of accumulated mutations to the gene. Base pair insertions are one class of mutations, i.e. they're not a separate thing. So why do you think mutations would make it difficult to make a prediction about gene similarity?

 

[Loudmouth]

my question to all of this is "how can you make any prediction at all with such things as HGT, gene mutation, and base pair insertions?"
these things would make predictions almost impossible.

Cycs, the gene we are using, was inherited vertically. Also, gene mutation and base pair insertions are exactly what make these predictions possible.

"It will be determined to what extent the phylogenetic tree, as derived from molecular data in complete independence from the results of organismal biology, coincides with the phylogenetic tree constructed on the basis of organismal biology. If the two phylogenetic trees are mostly in agreement with respect to the topology of branching, the best available single proof of the reality of macro-evolution would be furnished. Indeed, only the theory of evolution, combined with the realization that events at any supramolecular level are consistent with molecular events, could reasonably account for such a congruence between lines of evidence obtained independently, namely amino acid sequences of homologous polypeptide chains on the one hand, and the finds of organismal taxonomy and paleontology on the other hand. Besides offering an intellectual satisfaction to some, the advertising of such evidence would of course amount to beating a dead horse. Some beating of dead horses may be ethical, when here and there they display unexpected twitches that look like life."

Emile Zuckerkandl and Linus Pauling, discussing the possibility of the twin nested hierarchy before the first molecular phylogenies had been made.
(1965) "Evolutionary Divergence and Convergence in Proteins." in Evolving Genes and Proteins, p. 101.

The prediction is that the number of mutations will correlate with evolutionary distance.

 

[Loudmouth]

of course they conclude that.
hypothesis are often reworded to specifically exclude anything creationists can use.

We need more than baseless allegations. Cite authors and papers which were reworded to exclude things that creationists could use.

yes, they conclude, and i agree, that common ancestry is the most logical answer, but the empirical evidence for this belief is lacking.

I am supplying that very empirical evidence in this thread.

 

[whois]

And yet we are able to make this kind of prediction quite easily, and they turn out to be correct in the overwhelming majority of cases. Perhaps you should refine your understanding of the effects of HGT, gene mutation and base pair insertions. As you have been told many times, HGT is so rare in vertebrates that it can usually be ignored. Do you not understand that, or not believe it, or what?

i hardly call 20,000 insertions trivial.

The other parts of your question are more puzzling. Gene mutation is precisely the basis of Loudmouth's ability to predict genetic similarity: the genetic divergence he's talking about is the result of accumulated mutations to the gene. Base pair insertions are one class of mutations, i.e. they're not a separate thing. So why do you think mutations would make it difficult to make a prediction about gene similarity?

because a single base pair insertion can completely "rearrange" an entire sequence.
if this base pair happens at a start or stop bit it can drastically alter the genetic code.
this also is hardly trivial.
since you cannot predict where this insertion will be, then you cannot possibly predict the outcome.

 

[Loudmouth]

i hardly call 20,000 insertions trivial.

HGT is easily differentiated from DNA that was inherited vertically.

because a single base pair insertion can completely "rearrange" an entire sequence.

Not at the DNA level. It is just an addition of one base.

ATTAGGCGCGGAGAGTTTTTAATGGGC
ATTAGGCGCGGAGGAGTTTTTAATGGGC

Pretty easy to see the single base indel.

if this base pair happens at a start or stop bit it can drastically alter the genetic code.

No, it doesn't. It may drastically alter the amino acid sequence of proteins, but that is not the genetic code. In fact, more than 95% of the genome isn't even translated into proteins.

since you cannot predict where this insertion will be, then you cannot possibly predict the outcome.

We can predict how often mutations will occur, which is all we need to know. This allows us to predict that there will be a correlation between number of mutations and time since common ancestry.

Also, since mutations occur nearly randomly within genome we can determine what percentage of mutations will occur in any gene, which is directly related to the size of the gene. If the exons in a gene add up to 3,000 bp in a 3 billion base pair genome, then each mutation has a 1 in 1 million chance of hitting that gene. When you have billions and billions of mutations, you can predict how many will occur in any given gene.

 

[sfs]

i hardly call 20,000 insertions trivial.

20,000 insertions of what, where and when?

because a single base pair insertion can completely "rearrange" an entire sequence.
if this base pair happens at a start or stop bit it can drastically alter the genetic code.

(You mean it can drastically alter the protein, not the genetic code.) True. In which case the mutation is very likely deleterious and will be removed by natural selection.

this also is hardly trivial.

In the rare event that a single-base insertion is not removed by selection, it will appear as a single mutational difference between the two copies of the gene, and will be included in the measured divergence that Loudmouth described.

since you cannot predict where this insertion will be, then you cannot possibly predict the outcome.

It doesn't matter where the insertion will be. Loudmouth wasn't comparing protein function; he was comparing DNA sequence. A single-base insertion in the DNA shows up as a single-base insertion -- easy to spot and easy to count.

So, could you try again? Why should mutations, and insertions in particular, make it hard to make predictions about sequence divergence?

 

[whois]

it's apparent i made the incorrect assumption that this thread is about predicting the outcome of genetic mutations.

 

[Loudmouth]

it's apparent i made the incorrect assumption that this thread is about predicting the outcome of genetic mutations.

You are using incorrect assumptions about genetic mutations.

We can predict how many mutations will occur in a given gene over a certain amount of time. It's as simple as using the mutation rate, population size, generation time, and size of the gene.

 

[Loudmouth]

Since creationists appear to be incapable of interpreting the data that has been presented, let's see how evolution does.

In contrast to creationism, evolution does make preditions. Just for review, here was the original challenge.

The similarity between the human and mouse gene is 90.5%. The similarity between the human and chicken gene is 81.6%.

Now comes the hard part. What does creationism predict will be the difference between the chicken and mouse cycs gene sequence, and why?​

Let's look at what we should see if evolution is true. If two lineages are no longer interbreeding, then they should be accumulating different mutations in each population. This means that the differences between the genomes will increase over time. Therefore, the differences between these genomes should be reflected by the amount of time between now and the time period when they first diverged from that common ancestor.

This makes for some really interesting comparisons because the common ancestor for chickens and mice is the same common ancestor for chickens and humans. Here is a cladogram for reference:

Both mice and humans trace back to the same node A. Therefore, the time since mice shared a common ancestor with chickens is the same amount of time since humans and chickens shared a common ancestor. This means that the difference between the mouse and chicken cycs gene should be comparable to the difference between the human and chicken cycs gene. It is what we call genetic equidistance. Is that what we see?

YES!!!!!!!

The DNA comparison is the number farthest right. When we compare mouse (M. musculus) and chicken (G. gallus) cycs we see that the genes are 81.9% similar. As shown before, the comparison for the human and chicken gene is 81.6%. 81.9% vs. 81.6%. That's nearly dead on.

Just goes to show that we actually do interpret the results using the theory of evolution. Creationists don't.

 

[whois]

there is one important point that everyone should know, and it's highly relevant to this topic.
this is a statistical analysis.
it's very easy to draw false statistical conclusions using such analysis.

 

[bhsmte]

there is one important point that everyone should know, and it's highly relevant to this topic.
this is a statistical analysis.
it's very easy to draw false statistical conclusions using such analysis.

Then it should be very easy for you to show the false conclusions.

 

[Loudmouth]

there is one important point that everyone should know, and it's highly relevant to this topic.
this is a statistical analysis.
it's very easy to draw false statistical conclusions using such analysis.

What statistical test did I use, and what is the probability that it is wrong?

 

[whois]

What statistical test did I use, and what is the probability that it is wrong?

DNA analysis, by it's very nature, must be statistical one, simply because it has no "standards".
for example, there is no "standard" cat or human, these must be dealt with in groups, or populations.