• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

Give me one beneficial mutation.

3sigma

Well-Known Member
Jan 9, 2008
2,339
72
✟3,007.00
Faith
Atheist
I am not an expert in the field of biology, but I am willing to take one on.
You admit that you know little of biology, yet you think you can effectively debate an expert in the field. I think there’s a word for that.

In any case, you asked for a single instance of evidence of a beneficial mutation. You’ve been given several now by people who appear to know a good deal more on the subject than you. Are you ready now to take the advice in your signature?
 
Upvote 0

Exiledoomsayer

Only toke me 1 year to work out how to change this
Jan 7, 2010
2,196
64
✟25,237.00
Faith
Atheist
Marital Status
Single
Heaven-Sent,

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

I think that between the three of them the goalposts should be fairly steadily locked down.
 
Upvote 0

Flatland

Junior Member
Aug 25, 2010
202
5
✟22,874.00
Faith
Atheist
I
My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.

Can your cat digest Nylon?


Let me ask you this....what would you accept as a "beneficial mutation?"

All of these are just using added existing code.

So what would qualify as new code?

You have no idea what you're talking about do you?

Creationism is beneficial, however some would argue it's not a mutation.

Sane people will argue that creationism doesn't exist
 
Last edited:
Upvote 0

Flatland

Junior Member
Aug 25, 2010
202
5
✟22,874.00
Faith
Atheist
Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.
 
Upvote 0

greenery

Active Member
Aug 31, 2010
37
1
✟22,662.00
Faith
Protestant
Marital Status
Private
Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.
Please remember that creationists are designed to be parrots and as such are only capable of repeating what they have been told, they know nothing about the questions they ask and would not understand any answers they were given.

I often think a creationists is like a person who learns to asks what the time is in a foreign language,
they can ask the question but are unable to understand the answer.

When a creationist gains actual knowledge they soon stop being creationists.
 
Upvote 0

MoonLancer

The Moon is a reflection of the MorningStar
Aug 10, 2007
5,765
166
✟29,524.00
Faith
Buddhist
Marital Status
In Relationship
My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.

Can your cat digest nylons and actually use it as food?

If you cant understand the answer to the question you asked, it will always seem unanswered. You probably cant even explain what type of answer your looking for. And if you cant do this then their is no point to answering your questions.
 
Upvote 0

Heaven-Sent

Active Member
Sep 3, 2010
43
2
✟22,673.00
Faith
Non-Denom
Marital Status
Private
In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...
 
Upvote 0

Flatland

Junior Member
Aug 25, 2010
202
5
✟22,874.00
Faith
Atheist
In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc

Please give us an example of what "new code" would look like.

If you're not going to tell us what you would accept as "new code" then you have no business asking for it.
 
Upvote 0

Exiledoomsayer

Only toke me 1 year to work out how to change this
Jan 7, 2010
2,196
64
✟25,237.00
Faith
Atheist
Marital Status
Single
In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

so just in case you missed it..

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial
 
Upvote 0

Heaven-Sent

Active Member
Sep 3, 2010
43
2
✟22,673.00
Faith
Non-Denom
Marital Status
Private
so just in case you missed it..

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

1. Mutation - A relatively permanent change in hereditary material involving either a physical change in chromosome relations or a biochemical change in the codons that make up genes.

2. A 5 legged horse.

3. Beneficial - Receiving or entitling one to receive an advantage.

Note: A 5 legged horse will not run faster then a 4 legged horse. An advantage would be for a horse to mutate wings and be able to fly. I would trade my car in for one of those bad boys. Scientists, get to work!
 
Upvote 0

MoonLancer

The Moon is a reflection of the MorningStar
Aug 10, 2007
5,765
166
✟29,524.00
Faith
Buddhist
Marital Status
In Relationship
1. Mutation - A relatively permanent change in hereditary material involving either a physical change in chromosome relations or a biochemical change in the codons that make up genes.

2. A 5 legged horse.

3. Beneficial - Receiving or entitling one to receive an advantage.

Note: A 5 legged horse will not run faster then a 4 legged horse. An advantage would be for a horse to mutate wings and be able to fly. I would trade my car in for one of those bad boys. Scientists, get to work!

your question was answered in the second post. new information was added and the old information was wiped this resulted in a benefit.
 
Upvote 0

Aianna

Vibrant Vegan
Oct 2, 2007
122
13
45
New York
✟22,803.00
Faith
Atheist
Marital Status
Single
Politics
US-Others
how about adding any letter besides a, c, g, or t.

So like when uracil was replaced by thymine when DNA evolved? I don't think that was a mutation, but you seem to be confused as to what a mutation is.

DNA is made up of four molecules that pair up with one another in sequence. The four main bases of DNA are cytosine, guanine, adenine, and thymine.

You CAN have bases other than those from mutations after the DNA has formed. One example of such a base is 5-methylcytosine.
 
Upvote 0

Flatland

Junior Member
Aug 25, 2010
202
5
✟22,874.00
Faith
Atheist
1. Mutation - A relatively permanent change in hereditary material involving either a physical change in chromosome relations or a biochemical change in the codons that make up genes.

All the examples given to you conforms to that definition.

3. Beneficial - Receiving or entitling one to receive an advantage.

All the examples given to you conforms to that definition.

Note: A 5 legged horse will not run faster then a 4 legged horse. An advantage would be for a horse to mutate wings and be able to fly. I would trade my car in for one of those bad boys. Scientists, get to work!

A horse mutating wings wouldn't be evolution; that would be magic.
 
Upvote 0

MoonLancer

The Moon is a reflection of the MorningStar
Aug 10, 2007
5,765
166
✟29,524.00
Faith
Buddhist
Marital Status
In Relationship
how about adding any letter besides a, c, g, or t.
all dna is comprised of acgt. all that changes is length and sequence. New information can be added with a mutation that changes the order of the dna. the new information replaces the old information.
 
Upvote 0

Flatland

Junior Member
Aug 25, 2010
202
5
✟22,874.00
Faith
Atheist
Gene duplication is not new code.

Gene duplication is a mutation. This thread is about beneficial mutations. You specifically asked for mutations not "new code." What part of that don't you understand?

Oh yeah, I'm still waiting for that example of what "new code" would look like.
 
  • Like
Reactions: driewerf
Upvote 0

Flatland

Junior Member
Aug 25, 2010
202
5
✟22,874.00
Faith
Atheist
How would this be magic? How did birds evolve?

Birds evolved through slow successive changes. They did not mutate wings. That would be magic.

In other words, birds evolved wings through many many (thousands, millions etc...) of mutations and not just through a single mutation.
 
Last edited:
Upvote 0