Give me one beneficial mutation.

[3sigma]

I am not an expert in the field of biology, but I am willing to take one on.

You admit that you know little of biology, yet you think you can effectively debate an expert in the field. I think there’s a word for that.

In any case, you asked for a single instance of evidence of a beneficial mutation. You’ve been given several now by people who appear to know a good deal more on the subject than you. Are you ready now to take the advice in your signature?

 

[Exiledoomsayer]

Heaven-Sent,

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

I think that between the three of them the goalposts should be fairly steadily locked down.

 

[Flatland]

I
My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.

Can your cat digest Nylon?


Let me ask you this....what would you accept as a "beneficial mutation?"

All of these are just using added existing code.

So what would qualify as new code?

You have no idea what you're talking about do you?

Creationism is beneficial, however some would argue it's not a mutation.

Sane people will argue that creationism doesn't exist

 

[Flatland]

Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.

 

[greenery]

Is is any of our local creatins going to give us an example of what a beneficial mutation would look like? Some how I highly doubt it...

Here, I'll even give you a hand. Below is an example of a genetic sequence:
acaagatgcc attgtccccc ggcctcctgc

Now please show us what a "beneficial mutation" should look like.

Please remember that creationists are designed to be parrots and as such are only capable of repeating what they have been told, they know nothing about the questions they ask and would not understand any answers they were given.

I often think a creationists is like a person who learns to asks what the time is in a foreign language,
they can ask the question but are unable to understand the answer.

When a creationist gains actual knowledge they soon stop being creationists.

 

[MoonLancer]

My cat eats cat food, but will also eat yogurt if I drop it on the floor. I made a smoothie earlier and some split on the ground, she ate that too. Like a vacuum cleaner, but no work involved.

Can your cat digest nylons and actually use it as food?

If you cant understand the answer to the question you asked, it will always seem unanswered. You probably cant even explain what type of answer your looking for. And if you cant do this then their is no point to answering your questions.

 

[Heaven-Sent]

In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

 

[Flatland]

In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

Here's an example of a genetic sequence:
acaagatgccattgtcccccggcctcctgc

Please give us an example of what "new code" would look like.

If you're not going to tell us what you would accept as "new code" then you have no business asking for it.

 

[Heaven-Sent]

how about adding any letter besides a, c, g, or t.

 

[Flatland]

how about adding any letter besides a, c, g, or t.

And what letters would that be? Do you even know what those letters stand for?

 

[Exiledoomsayer]

In every case given here, the mutation involves existing code. Show me the addition of new code. To put it simply:

A car has many parts. To make it run faster, louder, or more efficiently I can change the arrangement of parts, add more of the existing parts, or take parts away. In every case I am not adding anything new to the car.

This is how all of the mutations listed in this thread have been. I've yet to see something with new code.

See sig...

so just in case you missed it..

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

 

[Heaven-Sent]

so just in case you missed it..

There are three things i would like you to do.
1. Define "mutation"
2. Give a example of a non-beneficial mutation
3. Define beneficial

1. Mutation - A relatively permanent change in hereditary material involving either a physical change in chromosome relations or a biochemical change in the codons that make up genes.

2. A 5 legged horse.

3. Beneficial - Receiving or entitling one to receive an advantage.

Note: A 5 legged horse will not run faster then a 4 legged horse. An advantage would be for a horse to mutate wings and be able to fly. I would trade my car in for one of those bad boys. Scientists, get to work!

 

[MoonLancer]

1. Mutation - A relatively permanent change in hereditary material involving either a physical change in chromosome relations or a biochemical change in the codons that make up genes.

2. A 5 legged horse.

3. Beneficial - Receiving or entitling one to receive an advantage.

Note: A 5 legged horse will not run faster then a 4 legged horse. An advantage would be for a horse to mutate wings and be able to fly. I would trade my car in for one of those bad boys. Scientists, get to work!

your question was answered in the second post. new information was added and the old information was wiped this resulted in a benefit.

 

[Aianna]

how about adding any letter besides a, c, g, or t.

So like when uracil was replaced by thymine when DNA evolved? I don't think that was a mutation, but you seem to be confused as to what a mutation is.

DNA is made up of four molecules that pair up with one another in sequence. The four main bases of DNA are cytosine, guanine, adenine, and thymine.

You CAN have bases other than those from mutations after the DNA has formed. One example of such a base is 5-methylcytosine.

 

[Flatland]

1. Mutation - A relatively permanent change in hereditary material involving either a physical change in chromosome relations or a biochemical change in the codons that make up genes.

All the examples given to you conforms to that definition.

3. Beneficial - Receiving or entitling one to receive an advantage.

All the examples given to you conforms to that definition.

Note: A 5 legged horse will not run faster then a 4 legged horse. An advantage would be for a horse to mutate wings and be able to fly. I would trade my car in for one of those bad boys. Scientists, get to work!

A horse mutating wings wouldn't be evolution; that would be magic.

 

[Heaven-Sent]

your question was answered in the second post. new information was added and the old information was wiped this resulted in a benefit.

Gene duplication is not new code.

 

[Heaven-Sent]

A horse mutating wings wouldn't be evolution; that would be magic.

How would this be magic? How did birds evolve?

 

[MoonLancer]

how about adding any letter besides a, c, g, or t.

all dna is comprised of acgt. all that changes is length and sequence. New information can be added with a mutation that changes the order of the dna. the new information replaces the old information.

 

[Flatland]

Gene duplication is not new code.

Gene duplication is a mutation. This thread is about beneficial mutations. You specifically asked for mutations not "new code." What part of that don't you understand?

Oh yeah, I'm still waiting for that example of what "new code" would look like.

 

[Flatland]

How would this be magic? How did birds evolve?

Birds evolved through slow successive changes. They did not mutate wings. That would be magic.

In other words, birds evolved wings through many many (thousands, millions etc...) of mutations and not just through a single mutation.