Endogenous retroviruses

[dad]

The single nested hierarchy of species is not a debatable topic. It's been well understood since Carl Linnaeus first discovered it nearly 300 years ago.

Actually, depending on what you mean, it is debatable. If you mean that man came from a shrew.

Perhaps the problem here is that you don't know what a nested hierarchy is. A nested hierarchy is an arrangement of objects (species in this case) such that you get groups(taxa) within groups. A bit like the folders on your hard drive.

All objects can be arranged, depends on who is doing the arranging.

Now, this nested hierarchy of species encompasses all living things.

We can put all living things in groups if we wish, sure. There are a few ways we can do this.

Evolution explains this nested hierarchy as being due to descent with modification. Each taxa defines a set of species that have inherited specific traits (such as a backbone, or an ERV) from an ancestor in which that trait first evolved.

Right, an obsene concept if ever there was one. To me it is like saying, we are octopusses, because we have arms.

If special creation were true, we'd not have a single tree, but multiple, little trees, each one rooted in one of these created kinds.

Oh, Ha. No, because of the fast adapting that could go on in the past! This means that a lot of evolution did go on, so we expect an arrangement like we see.

If special creation were true, there is nothing that prevents a creator from making whales with gills. But that cannot be reconciled with evolution.

What prevents Him having made things like they are???

Modern taxonomy is done using cladistic methods, which are statistical algorithms that produce the most likely phylogenies based on a character matrix for a given set of species.

Most likely assuming they were not created. Trying to cook up the best self made explanation with no creation, assuming evolution from the worm. Pointless stats, to say the least.

The method is robust, and we find that the results of these methods produce trees that are converging on a single, true phylogeny.

No, you don't. Nothing true about it. The creation and the fantastic subsequent evolving, you simply lump together, and run a ridiculous assumption based statistical algorithm, to cook up an imaginary tree with all creatures on it.

There is no reason to expect this to be true if special creation were true. If special creation were true, we'd have to imagine that god created these kinds such that they'd appear to be related. Sounds like a pretty tricky god to me.

No! You simply thought the evolution that did go on was all that went on.

Whatever the case, you have still not proposed an explanation in which a single, nested hierarchy of species is a required consequence.

Read this post, I did that. Creation + hyperevolution = whatwesee.

The single nested hierarchy of species. That birds are tetrapods unites them with humans. That fungi and plants are eukayotes unites them with animals. All species are on the same tree.

Ha! Calling fungi eukayotes doesn't unite it with me!
"
eukaryote(Science: cell biology) organism whose cells have chromosomes with nucleosomal structure and separated from the cytoplasm by a two membrance nuclear envelope and compartmentalisation of a function in distinct cytoplasmic organelles. "
http://www.biology-online.org/dictionary/Eukaryote

'Gee, we have cells, and chromosomes with some structure, we are all a big happy family, the worms, and fungi and us'
That is your whole arguement. You have to go to school for that???!!!

But you see, the nested hierarchy of species DOES have real import. It exists. It is a real thing. A thing that creationists cannot explain, absent a bunch of hand waving.

In this you are almost correct. The most parsimoneous explanation for the presence of orthologous endogenous retroviruses is inheritence. But there is no reason to go special pleading humans out of that equation. When humans and chimpanzees share such a genetic trait, then we must follow the evidence and say that they inherited this genetic feature from a common ancestor.

I already covered that we don't know the past state, and how life processes were, and the retrovirus ancestor got around.
All we can see is that it was passed down. And where's that?

 

[mark kennedy]

You shouldn't link to html's stored on your local hard drive unless you expect us to hack into it. XD link's here: http://biology.plosjournals.org/perlserv?request=get-document&doi=10.1371/journal.pbio.0030110

My bad, I must have a too many windows open.

Look at the qualifications they attach to their research:

Based on analysis of finished BAC chimpanzee genome sequence, we characterize a retroviral element (Pan troglodytes endogenous retrovirus 1 [PTERV1]) that has become integrated in the germline of African great ape and Old World monkey species but is absent from humans and Asian ape genomes. We unambiguously map 287 retroviral integration sites and determine that approximately 95.8% of the insertions occur at non-orthologous regions between closely related species. Phylogenetic analysis of the endogenous retrovirus reveals that the gorilla and chimpanzee elements share a monophyletic origin with a subset of the Old World monkey retroviral elements, but that the average sequence divergence exceeds neutral expectation for a strictly nuclear inherited DNA molecule. Within the chimpanzee, there is a significant integration bias against genes, with only 14 of these insertions mapping within intronic regions. Six out of ten of these genes, for which there are expression data, show significant differences in transcript expression between human and chimpanzee. Our data are consistent with a retroviral infection that bombarded the genomes of chimpanzees and gorillas independently and concurrently, 3–4 million years ago. We speculate on the potential impact of such recent events on the evolution of humans and great apes.

They find PTERV1 in African great ape and Old World monkey species but is absent from humans and Asian ape genomes. This should be good.

Note the three independent verifications of horizontal transfer:

1. Non-orthology of insertion locations.
2. PTERV phylogeny inconsistent with primate phylogeny.
3. Significantly higher single-nucleotide substitution rate.

Sounds about right.

Now, if we only had a phylogenetic mismatch, but orthologous insertions and normal mutation rates, I would agree that there was something fishy. As it is, we have confirmation of horizontal transfer that is completely independent of the phylogenetic relationships concerned. So this does not amount to a substantive disproof of ERV phylogeny, as far as I'm concerned it looks like you're grasping at straws since we've already dealt with PtERV in your ERV thread weeks ago.

Frankly, nothing has been dealt with. Lets take another look at this:

1) The germline invasion supposedly happened 25-30 mya before the OWM /NWM split.

2) The (HERVK10) is the last active ERV in the human genome and insertions are rare to begin with.

3) ERVs make up 8% of the human genome, which means hundreds of millions of base pairs are simply remnants or duplications of ancient retroviruses.

4) PtERV is found in African great apes and OWM but is absent in human and Asian great apes.

The homology arguement you are using, and that is what it is, fails to provide consistant proof. I keep trying to track down what you guys are saying but I still don't find these mystery ERVs that you are talking about. Where are they, what are they called, what class of ERV are they?

Better yet, characterize an orthologous ERV insertion and identify it. I'm getting tired of seeing this talked in circles, where are these mystery ERVs you guys want to pontificate about endlessly?

Nothing is going to be dealt with until you identify these ERVs you are making such a fuss about.

 

[Chalnoth]

Mark, please stick to ERV's that are at orthologous positions for dealing with evidence of common ancestry. ERV's that are not found at orthologous positions are irrelevant to the discussion.

 

[mark kennedy]

Mark, please stick to ERV's that are at orthologous positions for dealing with evidence of common ancestry. ERV's that are not found at orthologous positions are irrelevant to the discussion.

No problem all you have to do is tell me of one, the class, location and comparison. I have asked you repeatedly to assign some qualification to what you are saying and you have not done so. If you want to talk about othologous positions then tell me the position of this supposed smoking gun.

By the way, I discovered a few on my own but I refuse to do your research for you. Either support what you are saying with actual facts are keep talking in circles, it makes no difference to me.

 

[Chalnoth]

No problem all you have to do is tell me of one, the class, location and comparison. I have asked you repeatedly to assign some qualification to what you are saying and you have not done so. If you want to talk about othologous positions then tell me the position of this supposed smoking gun.

And I have pointed out to you where you can find them. Lebedev et. al. 2000 lists 11 separate ERV's that are found at orthologous positions in different species, and three more that are only found in humans. As they state in their abstract, they found these ERV's by looking at positions that were known to be orthologous between humans and other primates, and looked for ERV's within those areas of the genome. They found 14 such ERV's in the human samples, and 11 of those were shared between other primate species, all consistent with the phylogenic tree.

How do you account for the fact that the human-only ERV's are by far a minority of the total number of ERV's found? How do you account for the fact that those that are shared are all consistent with the phylogenic tree?

 

[mark kennedy]

And I have pointed out to you where you can find them. Lebedev et. al. 2000 lists 11 separate ERV's that are found at orthologous positions in different species, and three more that are only found in humans. As they state in their abstract, they found these ERV's by looking at positions that were known to be orthologous between humans and other primates, and looked for ERV's within those areas of the genome. They found 14 such ERV's in the human samples, and 11 of those were shared between other primate species, all consistent with the phylogenic tree.

How do you account for the fact that the human-only ERV's are by far a minority of the total number of ERV's found? How do you account for the fact that those that are shared are all consistent with the phylogenic tree?

I account for them by dismissing the claim that all the ERVs are the result of germline invasions. We are talking about 8% of 3 billion base pairs. What do you think the odds are of 11 being the same when we are talking about hundreds of millions of base pairs?

Now go back and find these obscure ERVs and tell me the name, location and comparison.

 

[Chalnoth]

I account for them by dismissing the claim that all the ERVs are the result of germline invasions. We are talking about 8% of 3 billion base pairs. What do you think the odds are of 11 being the same when we are talking about hundreds of millions of base pairs?

The experimental group didn't look all over the genome for the same sequence. They sequenced specific areas of each genome that were known to be orthologous. In some species they got, for example:

ATCATAGCCTTACG

Whereas in other species they got:
ATCATAGGTCACCTAGCCCTTACG

...or something to that effect (though with a few random mutations thrown in for good measure). In some species you get one type of gene. In other species you get the other. These genes are clearly inherited. And the similarities exist only within a pattern consistent with a hierarchical structure.

We don't need to worry about where the similarity came from, just that it can be inherited, and exists in some species but not others. As an argument for common descent, that's all you need. Hierarchical structure of inherited traits = common descent. Unless you can think of another method for generating a hierarchical structure.

 

[Ondoher]

Actually, depending on what you mean, it is debatable. If you mean that man came from a shrew.

The nested hierarchy of species existed prior to our explaining it. Absent common ancestry it doesn't make sense. But its existence is not in doubt.

All objects can be arranged, depends on who is doing the arranging.

In this case, it was originally Carl Linnaeus, a devout christian. But that's not really important right now. What is important is that this arrangement of species is not arbitrary. It is actually a natural, nested hierarchy. This means that we do not find species that should be classified in multiple taxa. Try grouping created objects into a nested hierarchy without finding out that something belongs in more than one group.

We can put all living things in groups if we wish, sure. There are a few ways we can do this.

And none of them make as much sense as the natural, nested hierarchy of taxonomy. That's why it's stuck for nearly 300 years.

Right, an obsene concept if ever there was one. To me it is like saying, we are octopusses, because we have arms.

Persdonal distate for something is not actually a valid argument against it. And no, taxonomy is nothing like your characterization of it. It is more like saying that eukaryotes are all species that have a cell nucleus and other internal organelles. Or that Deuterstomes are all species that develop an anus before a mouth. Interesting fact, all chordates are deuterstomes. I've yet to have a creationist explain why this must be so.

Oh, Ha. No, because of the fast adapting that could go on in the past! This means that a lot of evolution did go on, so we expect an arrangement like we see.

How does rapid divergence of created kinds lead to a single nested hierarchy of species?

What prevents Him having made things like they are???

Nothing. But nothing requires it either. A creator can explain any natural organization of species, from a linnear progression, to an undirected graph, to no organization at all with each species being entirely unique.

Most likely assuming they were not created. Trying to cook up the best self made explanation with no creation, assuming evolution from the worm. Pointless stats, to say the least.

No, most likely meaning most parsimoneous. That is, it builds a phylogeny that makes the fewest assumptions. These methods will work with any type of object, doesn't even need to be biological. You just won't get very good statistical support for your results.

No, you don't. Nothing true about it. The creation and the fantastic subsequent evolving, you simply lump together, and run a ridiculous assumption based statistical algorithm, to cook up an imaginary tree with all creatures on it.

No, what we do is run the algorithms on various taxa, using relevent character matrices to test hypotheses about relationships. What we find is that results of such independent tests are consistent. This supports the hypotheses that there is a single, true phylogeny of living things.

No! You simply thought the evolution that did go on was all that went on.

This response does not appear to make sense given what it appeared to be intended to address. If special creation were true, we would not expect to get a single nested hierarchy from taxonomy.

Read this post, I did that. Creation + hyperevolution = whatwesee.

Your post has not explained how a single nested hierarchy of species is a required outcome of any form of creationism

Ha! Calling fungi eukayotes doesn't unite it with me!
"
eukaryote(Science: cell biology) organism whose cells have chromosomes with nucleosomal structure and separated from the cytoplasm by a two membrance nuclear envelope and compartmentalisation of a function in distinct cytoplasmic organelles. "
http://www.biology-online.org/dictionary/Eukaryote

'Gee, we have cells, and chromosomes with some structure, we are all a big happy family, the worms, and fungi and us'
That is your whole arguement. You have to go to school for that???!!!

Humans are eukaryotes. Fungii are eukaryotes. Plants are eukaryotes. How do you explain that?

I already covered that we don't know the past state, and how life processes were, and the retrovirus ancestor got around.
All we can see is that it was passed down. And where's that?

Yes, it was passed down from a common ancestor in which the original infection took place. And that individual would have been ancestral to humans and chimpanzees.

 

[shernren]

1) The germline invasion supposedly happened 25-30 mya before the OWM /NWM split.

That's plain wrong, the abstract of the article states that the PtERV intrusion happened roughly 3-4mya.

4) PtERV is found in African great apes and OWM but is absent in human and Asian great apes.

At non-orthologous positions, which makes all the difference.

The homology arguement you are using, and that is what it is, fails to provide consistant proof. I keep trying to track down what you guys are saying but I still don't find these mystery ERVs that you are talking about. Where are they, what are they called, what class of ERV are they?

Better yet, characterize an orthologous ERV insertion and identify it. I'm getting tired of seeing this talked in circles, where are these mystery ERVs you guys want to pontificate about endlessly?

Nothing is going to be dealt with until you identify these ERVs you are making such a fuss about.

Here's a good old one:

Unique cellular flanking-sequence probes (Fig. 1) have
been used to locate individual proviral genomes to human
chromosomes 1 and 5 and to detect unique integration sites
(13). A single 7.3-kbp fragment generated by double digestion
with EcoRI-XhoI hybridized to both the HLM-2 gag
region and the 5' unique cellular flanking-sequence probes
(Fig. 1 and SA). As in the transfectant and the human (Fig.
5A and B, lanes 1 and 2, respectively), common chimpanzee
and gorilla DNAs showed the single 7.3-kbp EcoRI-XhoI
fragment when the HLM-2 5'-flanking probe was used (Fig.
5B, lanes 3 and 4). This suggests that the genomic DNAs of
the two African apes contain the HLM-2 proviral genome at
the same site as does the human genomic DNA. Although
EcoRI-XhoI digests of orangutan DNAs resolved a 7.3-kbp
fragment, additional low-molecular-weight bands appeared
(Fig. 5B, lane 5). In contrast to those of the three large apes,
DNAs from the lesser ape lar gibbon did not cross-hybridize
to the HLM-2 gag probe (Fig. 4D) or to the HLM-2 5' unique
cellular flanking-sequence probe (data not shown) at high
stringency. This is consistent with the lack of characteristic
HLM-2 proviral internal fragments, e.g., env (Fig. 4A and B)
and pol (data not shown), and suggests that, although lar
gibbon DNA has HERVII-related sequences, it does not
contain the HLM-2 proviral genome.
The presence of the HLM-2 provirus in large apes and
humans corresponds to their phylogenetic relationships instead
of their current geographic distribution (8, 11, 12, 14,
20, 21, 25). The observed hybridization patterns suggest
either that the human HLM-2 proviral genome was inherited
from a common ancestor of all the extant large hominoids
after the divergence of the lesser ape lineage (11) or that this
region of the lar gibbon genome was lost subsequent to the
divergence of lar gibbons from large hominoids. We favor
the former possibility, since the restriction patterns of HLM-
2 proviral env, gag, and flanking sequences are consistent
with the evolutionary branching order of orangutans, African
apes, and humans (11, 21). This issue should be resolved
with studies using additional cellular DNA probes flanking
the HLM-2 provirus or other HERVII proviral genomes. In
this regard, another human endogenous proviral genome,
ERV-1, which is unrelated to the HERVII family, is known
to have entered the human germ line prior to the chimpanzee-
human branch point (3).
The possibility that the HERVII family of endogenous
retrovirus sequences entered the catarrhine lineage via an
ancient infection is suggested by the following observations:
the presence of all the HERVII internal sequences in all the
species of Old World simian primates tested, the similarity of
HLM-2 proviral patterns in humans and large apes, and the
absence of HERVII structural sequences in New World
monkeys. A HERVII infection of early catarrhines would
therefore have occurred after the geographic separation
between the Old and the New World anthropoid lineages,
i.e., approximately 40 million years ago (7, 9-11) but before
the evolutionary radiation and geographic dispersal (outside
Africa) of the ancestors of the extent large hominoids
(estimated at 17 million years ago) (1, 2, 19, 24).

http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=2507793

 

[dad]

The nested hierarchy of species existed prior to our explaining it. Absent common ancestry it doesn't make sense. But its existence is not in doubt.

It existed prior to evolution because it has nothing to do with evolution. AS I pointed out, nothing about it precludes the ancestor created kinds, that have undrgone great rapid evolution.

In this case, it was originally Carl Linnaeus, a devout christian. But that's not really important right now. What is important is that this arrangement of species is not arbitrary. It is actually a natural, nested hierarchy. This means that we do not find species that should be classified in multiple taxa. Try grouping created objects into a nested hierarchy without finding out that something belongs in more than one group.

When you get to genus, it seems we are getting pretty close to the created kinds. Some might say it was family. Beyond that, the grouping really has not got much meaning.

Persdonal distate for something is not actually a valid argument against it. And no, taxonomy is nothing like your characterization of it. It is more like saying that eukaryotes are all species that have a cell nucleus and other internal organelles.

Right, which is saying nothing much at all really, is it? That is a ridiculously broad cath phrase that catches almost everything normally thought of as creatures.

Or that Deuterstomes are all species that develop an anus before a mouth.

Now that is something evos might be interested in.

Interesting fact, all chordates are deuterstomes. I've yet to have a creationist explain why this must be so.

What is interesting about it? Why would the average person, or creationist care?

How does rapid divergence of created kinds lead to a single nested hierarchy of species?

Simple,
"..placing all living beings in a nested structure of divisions related to their probable evolutionary descent. " wickopedia
So, if we had a lot of adapting and evolving we have a lot of creatures that muddle the picture of what 'probable evolution' might be! If a cat from Noah's ark adapted, and evolved into 30 something species.
"Linnaeus originally classified all the cats into a single genus, Felis within the Felidae family. However, there were obviously cats of several broad types and zoologists began to group these together and added new genera in the process. At one point the single genus Felis had diversified into no less than 23 different genera. Many experts believed that the splitting up had gone too far and there was a tendency to regroup. This tendency continued until a few years ago, when most authorities considered that there were just three genera - Felis for all the small cats, Panthera for the big cats (which are defined by their ability to roar) and Acinonyx for the cheetah. "
http://www.bigcats.org/abc/catspecies/species.html
So, if all these came as evolved species from the one on the ark, where does that leave your little ever changing classification system!!!!?? Even if we had, say, a couple on the ark, and maybe just the one in Eden to start!!!!?

No, most likely meaning most parsimoneous. That is, it builds a phylogeny that makes the fewest assumptions. These methods will work with any type of object, doesn't even need to be biological. You just won't get very good statistical support for your results.

Right, I can do that as well, and not omit creation for a wonderful simple picture. Using as a starting point, the same creatures we see here today.

No, what we do is run the algorithms on various taxa, using relevent character matrices to test hypotheses about relationships.

Do you run the two cats on the ark in there, and all the species that evolved since? The one elephant? The one horse pair? Etc? Do you run the adapting that went on for 1600 years before that as well, in other life here? Is God omitted in the relationship?

What we find is that results of such independent tests are consistent. This supports the hypotheses that there is a single, true phylogeny of living things.

I'm sure. Which is why it is a statement of faith, and nothing in this world more. Just because it is based on the creation, and subsequent adaptations, doesn't mean you can understand it by assuming we came from worms!!

If special creation were true, we would not expect to get a single nested hierarchy from taxonomy.

I think I just covered that.

Humans are eukaryotes. Fungii are eukaryotes. Plants are eukaryotes. How do you explain that?

Easy as pie! You like to call plants, and humans by a common name! Pretty silly name at that. I mean, someone could say, all things with eyes or sonar, or hearing, are Percepterians. Then I could say you and fish, and all kinds of things are percepterians. So?? Your desperation in finding something in common with fungi, and worms is becoming a concern here! And, no, I am not a fungaphobic.

Yes, it was passed down from a common ancestor in which the original infection took place. And that individual would have been ancestral to humans and chimpanzees.

Not if the ancestor of the retrovirus, in the different past could jump species, unlike now! Then, as I say, it would get passed down by the kinds of species it was in, down the line! This means we need no common ancestor to explain ERVs at all.

If you want to talk other things, as I said, we could have seen some wicked pre flood man monkey action.

 

[Tomk80]

No, you interpret the evidence that way. How do you get from fast evolution in Noah's day, to man coming from a tree shrew?

You don't. Noah did not exist, the flood never happened. You go from the evidence, if you do that you get to the universal common ancestor.

Your dream tree is based on what, really? Similarities and creation building blocks detected in creatures.

No, only similarities. Grouping things, that is what the tree is based on. Do it with animals, you get a tree. Do it with anything that is designed, and you don't.

You may even have some real evolution from created creatures into a whole plethora or group of species from the one kind. But that does not take man up into a real tree as a little shrew!

No, but the evidence does. Whatever your funny fantasies, dad, they do not top evidence.

Creation is a twin nested heirarchy when the original kinds adapt down to what we have today. Not up, as evolution teaches!

Then there is only one original created kind for the whole of biological diversity, because the whole of biological diversity fits into one single nested hierarchy.

Yes, all evidence we see fits the created kinds that God origianally made here. Can you show me one thing it does not fit?

I can show you how it fits that all life shows a common ancestor. Now, can you show me where the tree of life breaks down?

Before we can break down an imaginary tree, we need to make it a real tree. Where does the creation tree break down??? If there was the one elephant created, and later it evolved, or adapted to the various species we have had, like mammoth, African, etc, then what evidence do you have it never started as the one kind? You can't say evolving, because we both allow that. Your breakdown comes at the points where you imagine the basic kind came from something else. That can't be supported, or I think you would do it, rather than post and post and post about how you have the evidence, just cough it up.

The twin-nested hierarchy is that answer.

Well, in the different past we had the retrovirus ancestor able to get across kind and species barriers, apparently.

Oh, apparantly. And nested itself in orthologous position also I presume?

So we could have ERVs in created kinds then, not passed down.

But why in orthologous positions?

After the big change came, we now have just the present way they get passed down, and inserted, etc. If all we look at is that, we would assume it was always the same, so there was a common ancestor. Since the same past is only assumed, I do not share that assumption, and see how the actual evidence fites the real creation tree, better than the imaginary evo tree.

Unless you have a mechanism how ERV's would fit themselves in orthologous positions in non-related 'kinds', whether the past was different makes not one iota of difference for the reasoning that man and chimps share one common ancestor.

As for things aside from ERVs, yes, science says that chimps did it with men in the past.

No, it doesn't. Get your science straight.

So we could have some similarities because of that wicked encounter time. Originally, I guessed that that also might have been one of the big causes of the ERV thing, but was barraged by evidences here, that I was on the wrong track. Being one that accepts actual evidence, I dropped that as a big factor for ERVs. But, yes, it certainly can be brought into play on other fronts.

Nope.

Well, God created man, and whatever primate, or apes, and monkey kinds He made in the beginning. If, near the tip of the creation tree branches, that branched out by the past ability to hyper adapt, wicked man mixed some genes with chimps, or other 'monkey' that gave chimps as an offspring, that is a possibility. In that sense, if true, we would share ancestors.

No, not in that sense. In the sense that we actually have an actual common ancestor, not your fantasy world.

That has nothing do do with ignoring creation, like the evo tree does, and claim we decended from a tree shrew!!!

It doesn't ignore creation, it derives directly from studying it.

Even more absurd, is what they claim came before that dream, now get this people, and feel the spirit that is behind the inspiration for the theory. (The enemy of our souls)
"This organism most likely was some kind of a worm. At some point this ancestral worm species divided into two separate worm species..."
http://tolweb.org/tree/learn/concepts/whatisphylogeny.html

Yup, that is right. And your evidence that this didn't happen is?

 

[Schroeder]

i think was a good point. if things mutate and change as you say then it is VERY possible these early retroviruses could have been able to get into different species and then mutated and can not now. which would show us what we see today. as seemingly being only passed through genes through reproduction by way of the theory. Or have they considered this.

 

[Ondoher]

It's almost as if we speak entirely different languages. I'm not sure if your inability to understand this is intentional or due to some huge conceptual gap.

I will attempt to explain it more carefully. Taxonomy is the science whereby we classify organisms. Over time, there have been many attempts to classify life, such as the great chain of being.

What Carl Linnaeus realized nearly 300 years ago, however, is that by carefully examining specific traits of living beings, species could be fit into a nested hierarchy based on the traits that they had in common. So, therefore, we get vertebrates, which consists of all the species that have a backbone. We get mammals that consists of all the species that feed their young with milk, and that have a single jaw bone and threee ear bones.

What we never find is a species that really belongs in multiple categories, like a bird with mammary glands. The nested hierarchy that Carl Linneaus described is therefore considered a natural nested hierarchy. And it encompasses all living things.

Since Carl Linnaeus' time, we have learned a lot more about embryology, paleontology and genetics. And all of this information has only acted to support and refine this nested hierarchy.

Without common ancestry, there is no explanation for this natural arrangement of species. Seen through evolution, however, we understand this hierarchy as being due to descent with modification. Each taxa described by taxonomy encompasses a set of species that inherited their diagnostic traits from some ancestor in which the traits first appeared. In fact, this organization of a nested hierarchy is the required consequence of descent with modification.

The only answer creationists can give for taxonomy is that god did it that way. But that answer can explain any natural arrangement of species. It therefore fails to explain any specific arrangement.

It existed prior to evolution because it has nothing to do with evolution. AS I pointed out, nothing about it precludes the ancestor created kinds, that have undrgone great rapid evolution.

But you have yet to expain how a nested hierarchy is the required consequence of any model of creationism. You simply keep asserting that position. That creationism can encompass any conceivable obversation is not actually a point in its favor.

When you get to genus, it seems we are getting pretty close to the created kinds. Some might say it was family. Beyond that, the grouping really has not got much meaning.

Except that the same logic that groups species into genus or family are able to keep grouping spcies into higher taxonomic levels. All vertebrates are vertebrates because of their shared character traits. Just like all Hominidae are Hominidae because of their shared traits, or Aves because of their shared traits.

Right, which is saying nothing much at all really, is it? That is a ridiculously broad cath phrase that catches almost everything normally thought of as creatures.

No, there is a huge difference between prokaryotic cells and eukaryotic cells. Not only do eukaryotic cells have nucleuses and chromosomes, they also have mitochondria to power them. All animals, all plants and all fungi are eukaryotes. All of them.

Now that is something evos might be interested in.

You apparently missed the point. Why is it that all chordates (which includes all vertebrates) develop an anus before they develop a mouth? It certainly seems like a rather arbitrary distinction, and yet it is consistently true. If descent with modification is true, then it is because this specific pattern of development was locked into the ancestor of all deuterstomes, and has been subsequently inherited by all of its descendents. How does a creationist explain this.

What is interesting about it? Why would the average person, or creationist care?

We are not talking about the average person, we are talking about taxonomists. It is interesting because it requires explanation.

Simple,
"..placing all living beings in a nested structure of divisions related to their probable evolutionary descent. " wickopedia
So, if we had a lot of adapting and evolving we have a lot of creatures that muddle the picture of what 'probable evolution' might be! If a cat from Noah's ark adapted, and evolved into 30 something species.
"Linnaeus originally classified all the cats into a single genus, Felis within the Felidae family. However, there were obviously cats of several broad types and zoologists began to group these together and added new genera in the process. At one point the single genus Felis had diversified into no less than 23 different genera. Many experts believed that the splitting up had gone too far and there was a tendency to regroup. This tendency continued until a few years ago, when most authorities considered that there were just three genera - Felis for all the small cats, Panthera for the big cats (which are defined by their ability to roar) and Acinonyx for the cheetah. "
http://www.bigcats.org/abc/catspecies/species.html
So, if all these came as evolved species from the one on the ark, where does that leave your little ever changing classification system!!!!?? Even if we had, say, a couple on the ark, and maybe just the one in Eden to start!!!!?

And how does that explain the fact that cats can be grouped with other Carnivoria, such as civets, based on shared traits. The logic that lets us group cats into a group also lets us extend that grouping to higher taxonomic levels.

Right, I can do that as well, and not omit creation for a wonderful simple picture. Using as a starting point, the same creatures we see here today.

Running cladistic methods on modern species will give you a single, nested hierarchy of species. One with stroing statistical support. There will be no evidence of created kinds.

Do you run the two cats on the ark in there, and all the species that evolved since? The one elephant? The one horse pair? Etc? Do you run the adapting that went on for 1600 years before that as well, in other life here? Is God omitted in the relationship?

You make no assumptions. You pick your taxa, you pick your most informative traits, and you run your algorithms. Computers do the rest. And out pops a tree.

I'm sure. Which is why it is a statement of faith, and nothing in this world more. Just because it is based on the creation, and subsequent adaptations, doesn't mean you can understand it by assuming we came from worms!!

Now there's a non sequitur if I ever saw one. I explain how we can consistently test and confirm hypotheses about specied relationships, and you claim that's evidence of faith. Since when is successful testing an element of faith?

I think I just covered that.

No, you didn't and I wish you would. You have to explain how a single nested hierarchy that encompasses all species is the required consequence of creationism.

Easy as pie! You like to call plants, and humans by a common name! Pretty silly name at that. I mean, someone could say, all things with eyes or sonar, or hearing, are Percepterians. Then I could say you and fish, and all kinds of things are percepterians. So?? Your desperation in finding something in common with fungi, and worms is becoming a concern here! And, no, I am not a fungaphobic.

And as shown above, the grouping of eukaryotes is not arbitrary.

Not if the ancestor of the retrovirus, in the different past could jump species, unlike now! Then, as I say, it would get passed down by the kinds of species it was in, down the line! This means we need no common ancestor to explain ERVs at all.

Retrovirues can and do infect multiple species. However, what we see is that when we get the same retroviral sequence in the same location in multiple species, that analysis of slight differences of these orthologous areas produces a phylogeny that is consistent with that created using other, independent data sets, thus further supporting the single, nested hierarchy of all living things.

If you want to talk other things, as I said, we could have seen some wicked pre flood man monkey action.

This was a nonseniscal close to your post. I do not see how it added anything.

 

[rmwilliamsll]

nested hierarchical structures seem to pose an intellectual barrier of understanding to some people here.

look at an army or a business organization.

if you start with one person: the top general or the CEO.
then create each new layer with a simple rule: no one can have more than 1 boss, everyone but the top must have one boss. you create a nested hierarchy.

why this is important is that life forms a nested hierarchy because genetics is only vertical. you get it from your parents only.

take another possible way life could operate. say you can take the DNA from your food and incorporate it into yourself. So you have bad eyesight and wear glasses, no problem, tomorrow you have owl or eagle for breakfast and poof, really good owl eyes in your head.

this creates chimeras, mixture of different genetic lines. these can not be arranged in a nested hierarchy. for they swap DNA between the lines, they have more than one boss an some stage of the organization chart (human plus owl).

nested hierarchies are a description of many things and how they can be organized. most things can not be placed into such organizational charts.

 

[Chalnoth]

i think was a good point. if things mutate and change as you say then it is VERY possible these early retroviruses could have been able to get into different species and then mutated and can not now. which would show us what we see today. as seemingly being only passed through genes through reproduction by way of the theory. Or have they considered this.

Parallel infection has occurred. But since viruses insert themselves at random locations in the genome, these viruses will look like the same virus in different species, but will exist at different places in the genome. The ERV's that are used for common descent exist at the same exact place in the genome.

 

[dad]

i think was a good point. if things mutate and change as you say then it is VERY possible these early retroviruses could have been able to get into different species and then mutated and can not now. which would show us what we see today. as seemingly being only passed through genes through reproduction by way of the theory. Or have they considered this.

Bingo.

 

[Chalnoth]

Parallel infection between species does not explain the nested hierarchy, dad.

 

[Loudmouth]

First of all, are you guys seriously on board with the prevailing view that all the ERVs are really the result of germline invasions?

Not all ERV's are going to be due to primary insertions. LTR's and pro-viruses can move through the genome through transposition and recombination. However, transposons and recombination are just as random as the original germ line insertion which still poses the problem of why there are shared sequences that fall into a nested hierarchy.

I don't know why the ERVs seem so convincing but it's not the simularities that are so stricking, it's the differences. I posted some things to the formal debate I am having with EA. If you guys want to take a look and bring some of the details up here I would be interested in what you have to say.

You keep citing non-orthologous ERV's which is the height of dishonesty. Until you start dealing with ERV's shard at orthologous positions there is nothing more to talk about. By obfuscating orthologous and homologous ERV's you have all but admitted how damaging orthologous ERV's are to the creationist paradigm.

 

[Loudmouth]

You are really going to have to come to grips with the fact that this buisness of ERVs being the result of germline invasions is wrong:



It's simple really, if they were not from a germline invasion then the whole probablity of seperate invasions at the exact same location goes up in smoke.

Doesn't matter. Transposition is just as random, although less rare, than primary ERV insertions. Do you really think that entire populations share transpositions at orthologous positions in their genome because of independent transposition events? Do you realize the odds against that happening?

Normally I would string this along but you are talking in circles. The source is absolutly essential to you arguement, you know what I am talking about right?

Why? Transposons move in an independent, random, and lineage specific manner just like ERV's.

Which family of ERVs to you want to talk about because I have yet to see one named. If you tell me which ones you are talking about then I can look them up but argueing in circles around probability statistics is pointless unless you know what the figures used were based on.

You still haven't agreed to a very simple and logical question. If all primates, humans included, share orthologous ERV's and transposons in orthologous positions, and those orthologous positions form a nested hierarchy that agrees with morphology, is this evidence of common ancestry? Until you give a yes or no answer there is no reason to look at sequence details.

You don't know how bad I want to know exactly how evolution works, that's your problem. I believe in a very radical version of evolution that does not include apes and humans having a common ancestor.

Based on what evidence?

That is enough, which ERVs are you talking about? I would like to know their location, class and how they have been characterized. I would just love to refute this ridiculas line of argumentation but you are simply arguing in circles.

You are avoiding the question. I will gladly spend the time to personally look up the sequenced data, including the flanking DNA, if you are willing to admit that orthologous ERV's are evidence for common ancestry. If you disagree, then why even mention the sequence data?

 

[Loudmouth]

I think it is time to cite a paper that I have cited numerous times in other ERV threads. This paper by Mitchel et al. (2004) details the insertion biases of three different retroviruses (HIV, ASLV, and MLV). They mapped the insertion of each virus into the genome, and what they found was that these viruses inserted randomly among thousands of possible insertion sites. For example, HIV demonstrated a tendency to insert into CpG islands. These genomic areas are 10's of thousands of bases long and interspersed throughout the genome. In fact, the researchers were able to map over 1,000 separate insertion sites for HIV in a single genome. They also found that ASLV and MLV inserted into different types of genome areas, but did so in a random pattern among all chromosomes. Here is the graph showing all of the insertions mapped onto the human genome. Figure and caption from Mitchell et al. 2004.

Relationship between Integration Sites and Transcriptional Intensity in the Human Genome
The human chromosomes are shown numbered. HIV integration sites from all datasets in Table 1 are shown as blue “lollipops”; MLV integration sites are shown in lavender; and ASLV integration sites are shown in green. Transcriptional activity is shown by the red shading on each of the chromosomes (derived from quantification of nonnormalized EST libraries, see text). Centromeres, which are mostly unsequenced, are shown as grey rectangles.