Watch and consider IV

[46AND2]

That's the problem here I am being totally reasonable. What I said makes sense. We look at what we have for what it is (void of speculative possibilities). It is fine to pose these speculative possibilities as what THEY are but no one should simply accept them as established truth (THAT is what is unreasonable).

It is the same basis of corpus delicti...show me the body...otherwise it is speculation...and THIS is reasonable.

You aren't being reasonable. What your argument boils down to is Ken Ham's "were you there?"

 

[pshun2404]

And we see a gene which looks exactly as it would if it was broken. And the manner in which it looks broken forms a nested hierarchy which is exactly what we would expect to see if evolution is true; indeed, evolution requires said nested hierarchy to be observed.

Not so! It looks exactly as it would if it were different (as do other forms of the same gene that are different in different organisms. Nested Hierarchy is a conceptual notion used to classify different orders of things based on similarity (They have features that look GENERALLY the same) nothing more, and thin from these intelligently designed data sets WE order them a second time (in tree like forms with imagined lines connecting different sets with no direct evidence of what the lines represent) into a graduated MODEL that represents what we want to use to persuade others that it makes sense (see Huff's How to Lie with Statistics)

 

[46AND2]

Not so! It looks exactly as it would if it were different (as do other forms of the same gene that are different in different organisms. Nested Hierarchy is a conceptual notion used to classify different orders of things based on similarity (They have features that look GENERALLY the same) nothing more, and thin from these intelligently designed data sets WE order them a second time (in tree like forms with imagined lines connecting different sets with no direct evidence of what the lines represent) into a graduated MODEL that represents what we want to use to persuade others that it makes sense (see Huff's How to Lie with Statistics)

Wrong. In order for evolution to be true, a nested hierarchy must be:

1. objective and
2. observed

And both are fulfilled.

It is a PATTERN of similarities. How many times must I point out that scientists don't just look at similarities, because that wouldn't indicate much? They look at observable, objective patterns of similarities.

If it were just a conceptual notion with no real meaning (just a way to organize, in other words), you could produce a nested hierarchy of any group of similar items. But you can't. It is unique to the idea of common ancestry.

 

[pshun2404]

No, it is not according to an historical narrative, it is according to the fact that the patterns of similarities form nested hierarchies.

The conclusion that the GULO gene is "broken" is not based on or because "the patterns of similarities form nested hierarchies" it is because in earlier creatures (not nearly ALL) it has one form and in higher order organisms (not ALL) it is represented by other versions and this CAN BE interpreted to support the Common Ancestor narrative (for which we have no demonstrable example).

We see this problem in other shared but allegedly mutated genes (when placed in a nested hierarchy)...consider another ALLEGED shared gene...

Human Gene HDLBP (uc002wba.1) a 110-kD protein that specifically binds HDL molecules, which functions in the removal of cellular cholesteral...it is a section 87,092 base pairs long

Rat Gene Hdlbp (NM_172039) which is only 68, 238 base pairs long performs a similar function but apparently not identically.

The allegedly the “SAME GENE” in Yeast, S. cerevisiae Gene SCP160 (YJL080C) functions differently and is primary to cell division, and only has 3,669 base pairs.

Finally, the alleged “SAME GENE” in D. Melongaster, Gene Dp1 (CG5170-RB). Having 9119 base pairs (3 times that of Yeast) seems to do nothing at all!

Now as fit as the hypothesis based explanation for this appears, the actual data shows us they actually are nothing alike...they are "different" in size and in function...yet billed as “commonly shared” in the rhetoric...and mutations of the earlier versions...but we have no real evidence of anything other than difference in different organisms...

Speculate by all means but don't insist the speculation is established as true...

 

[46AND2]

The conclusion that the GULO gene is "broken" is not based on or because "the patterns of similarities form nested hierarchies" it is because in earlier creatures (not nearly ALL) it has one form and in higher order organisms (not ALL) it is represented by other versions and this CAN BE interpreted to support the Common Ancestor narrative (for which we have no demonstrable example).

We see this problem in other shared but allegedly mutated genes (when placed in a nested hierarchy)...consider another ALLEGED shared gene...

Human Gene HDLBP (uc002wba.1) a 110-kD protein that specifically binds HDL molecules, which functions in the removal of cellular cholesteral...it is a section 87,092 base pairs long

Rat Gene Hdlbp (NM_172039) which is only 68, 238 base pairs long performs a similar function but apparently not identically.

The allegedly the “SAME GENE” in Yeast, S. cerevisiae Gene SCP160 (YJL080C) functions differently and is primary to cell division, and only has 3,669 base pairs.

Finally, the alleged “SAME GENE” in D. Melongaster, Gene Dp1 (CG5170-RB). Having 9119 base pairs (3 times that of Yeast) seems to do nothing at all!

Now as fit as the hypothesis based explanation for this appears, the actual data shows us they actually are nothing alike...they are "different" in size and in function...yet billed as “commonly shared” in the rhetoric...and mutations of the earlier versions...but we have no real evidence of anything other than difference in different organisms...

Speculate by all means but don't insist the speculation is established as true...

If the observations of the Gulo gene fit into a nested hierarchy (and it does), then it most certainly DOES mean that the conclusion is based on patterns of similarity. It is the whole purpose of a nested hierarchy; to show the pattern of similarity.

 

[pshun2404]

Wrong. In order for evolution to be true, a nested hierarchy must be:

1. objective and
2. observed

And both are fulfilled.

Not at all...I know you believe it is (just as I did) but it is not! Evolution can be true and the nested hierarchy full of assumption based errors. This why some have traded the tree for a bush and a few for possibly a couple or few interacting bushes...also the lines are all imagination designed to make the nests fit the theoretical model...they are not actually there but imposed (WE draw them where WE think they would go and then as time passed as we found we were in error in stead of admitting (WE'RE WRONG) WE create new nestings and new lines are proposed)

Finally YES...IF the totally conceived and non-demonstrated LUCA is true THEN a nested hierarchy will BE....

 

[46AND2]

Wrong. In order for evolution to be true, a nested hierarchy must be:

1. objective and
2. observed

And both are fulfilled.

Not at all...I know you believe it is (just as I did) but it is not! Evolution can be true and the nested hierarchy full of assumption based errors. This why some have traded the tree for a bush and a few for possibly a couple or few interacting bushes...also the lines are all imagination designed to make the nests fit the theoretical model...they are not actually there but imposed (WE draw them where WE think they would go and then as time passed as we found we were in error in stead of admitting (WE'RE WRONG) WE create new nestings and new lines are proposed)

Finally YES...IF the totally conceived and non-demonstrated LUCA is true THEN a nested hierarchy will BE....

When I discuss common ancestry, I generally stick with the more recent part of the "bush," as I am not well versed in microbiology, horizontal gene transfer and all that. Not to mention the fact that we have MUCH more data for the most recent portion of the tree.

And yes, the nested hierarchies we observe among primates and humans and mammals in general, from many independent fields of study, are absolutely objective.

 

[pshun2404]

If the observations of the Gulo gene fit into a nested hierarchy (and it does), then it most certainly DOES mean that the conclusion is based on patterns of similarity. It is the whole purpose of a nested hierarchy; to show the pattern of similarity.

It so-called "fits" because it is part of different creatures (so arranged) that all display this gene in one form or another just as my example of HGLBP (I know you know this is true but cannot speak it out loud) and this says nothing about it being "broken". Our version may simply be our version to allow us to digest Vit C...which if true would mean we were never meant to produce our own...or for some other reason. Unless you can show me an early human where it is allegedly unbroken or the Common Ancestor's genome for comparison it remains a hypothesis based conclusion.

 

[pshun2404]

When I discuss common ancestry, I generally stick with the more recent part of the "bush," as I am not well versed in microbiology, horizontal gene transfer and all that. Not to mention the fact that we have MUCH more data for the most recent portion of the tree.

And yes, the nested hierarchies we observe among primates and humans and mammals in general, from many independent fields of study, are absolutely objective.

Yes, as objective as we can be IF we are convinced of the hypothesis (I no longer am).

 

[46AND2]

It so-called "fits" because it is part of different creatures (so arranged) that all display this gene in one form or another just as my example of HGLBP (I know you know this is true but cannot speak it out loud) and this says nothing about it being "broken". Our version may simply be our version to allow us to digest Vit C...which if true would mean we were never meant to produce our own...or for some other reason. Unless you can show me an early human where it is allegedly unbroken or the Common Ancestor's genome for comparison it remains a hypothesis based conclusion.

Is it, or is it not consistent with the hypothesis of it being a broken gene? Whether you think there are other explanations or not, you should be able to see that it is consistent.

 

[46AND2]

Yes, as objective as we can be IF we are convinced of the hypothesis (I no longer am).

That would make it subjective. It is not. The data fits into nested hierarchical patterns. Period.

 

[pshun2404]

That would make it subjective. It is not. The data fits into nested hierarchical patterns. Period.

Yes but WE create the nests based on how WE interpret what we see as constituting "patterns"

Where the HLDBP was only one example...

Do you realize that there actually is a level of indicators for independent origins that atheist evolutionists should really admit but cannot not? They just cannot consider these in their presentations with subjects like the GULO because their cognitive dissonance would stick out even to themselves. We see these in studies suggesting convergent evolution, parallel evolution, recurrent evolution, convergence cascades, and more depending on “the patterns” one perceives.

Therefore to SUPPOSE the actually relatively few similarities as proof of common descent, by avoiding the many more “similarities” that may demonstrate what may be contrary to a common descent interpretation IMO simply demonstrates a very real confirmation bias.

These studies and OBSERVATIONS are not from some “creationist” models but by other non-creationist scientists. Many genes that were considered pseudo because allegedly they no longer have a function (hence the term pseudo-) have been shown NOW (like HDLBP) to still have function (hence not pseudo- at all) just a different one in that respective organism.

So I will now pose a question for you...can you at least show me how any specific gene initially “evolved” and came into being? To show its original purpose so we can compare...

 

[46AND2]

Yes but WE create the nests based on how WE interpret what we see as constituting "patterns"

Where the HLDBP was only one example...

Do you realize that there actually is a level of indicators for independent origins that atheist evolutionists should really admit but cannot not? They just cannot consider these in their presentations with subjects like the GULO because their cognitive dissonance would stick out even to themselves. We see these in studies suggesting convergent evolution, parallel evolution, recurrent evolution, convergence cascades, and more depending on “the patterns” one perceives.

Therefore to SUPPOSE the actually relatively few similarities as proof of common descent, by avoiding the many more “similarities” that may demonstrate what may be contrary to a common descent interpretation IMO simply demonstrates a very real confirmation bias.

These studies and OBSERVATIONS are not from some “creationist” models but by other non-creationist scientists. Many genes that were considered pseudo because allegedly they no longer have a function (hence the term pseudo-) have been shown NOW (like HDLBP) to still have function (hence not pseudo- at all) just a different one in that respective organism.

So I will now pose a question for you...can you at least show me how any specific gene initially “evolved” and came into being? To show its original purpose so we can compare...

No, we simply observe the patterns. We can't invent patterns which aren't there.

 

[46AND2]

Yes but WE create the nests based on how WE interpret what we see as constituting "patterns"

Where the HLDBP was only one example...

Do you realize that there actually is a level of indicators for independent origins that atheist evolutionists should really admit but cannot not? They just cannot consider these in their presentations with subjects like the GULO because their cognitive dissonance would stick out even to themselves. We see these in studies suggesting convergent evolution, parallel evolution, recurrent evolution, convergence cascades, and more depending on “the patterns” one perceives.

Therefore to SUPPOSE the actually relatively few similarities as proof of common descent, by avoiding the many more “similarities” that may demonstrate what may be contrary to a common descent interpretation IMO simply demonstrates a very real confirmation bias.

These studies and OBSERVATIONS are not from some “creationist” models but by other non-creationist scientists. Many genes that were considered pseudo because allegedly they no longer have a function (hence the term pseudo-) have been shown NOW (like HDLBP) to still have function (hence not pseudo- at all) just a different one in that respective organism.

So I will now pose a question for you...can you at least show me how any specific gene initially “evolved” and came into being? To show its original purpose so we can compare...

Oh, by the way, it isn't just patterns of similarities, but patterns of differences, too, which is often even more important.

 

[46AND2]

To demonstrate that the patterns are just THERE, here are the gulo gene sequences for human, chimp, orangutan, and macaque:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC[Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC[Chimpanzee GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC[Orangutan GULOP (Exon10)]

AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC[Macaque GULOP (Exon10)]

When you simply plug in the data (the sequences of each species), phylogenetic software creates a cladogram by looking at the differences between each sequence. What we get is this:

Which matches exactly with hierarchies derived through other completely independent means.

You can read about it in this thread here:

GULO Pseudogene as evidence for common ancestry among primates

The pattern is objectively there. Based solely on data, and not interpretation.

 

[46AND2]

To demonstrate that the patterns are just THERE, here are the gulo gene sequences for human, chimp, orangutan, and macaque:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC[Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC[Chimpanzee GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC[Orangutan GULOP (Exon10)]

AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC[Macaque GULOP (Exon10)]

When you simply plug in the data (the sequences of each species), phylogenetic software creates a cladogram by looking at the differences between each sequence. What we get is this:

Which matches exactly with hierarchies derived through other completely independent means.

You can read about it in this thread here:

GULO Pseudogene as evidence for common ancestry among primates

The pattern is objectively there. Based solely on data, and not interpretation.

And before you go on about doctored algorithms of the software or some such, just do it yourself.

There are a lot of common bases between all 4 species, so you start there. That's the bottom node in the above picture.

Now, get rid of all the common bases (gasp! ), and start comparing all the letters which differ in at least one of the four.

What is shown is the pattern of differences in the four sequences, regardless of interpretation: is it consistent with god designing it that way? sure (but then, any output could be). Is it consistent with common ancestry? yes (and there are MANY outputs which would not be).

 

[pshun2404]

Oh, by the way, it isn't just patterns of similarities, but patterns of differences, too, which is often even more important.

I agree...

 

[pshun2404]

To demonstrate that the patterns are just THERE, here are the gulo gene sequences for human, chimp, orangutan, and macaque:

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC[Human GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC[Chimpanzee GULOP (Exon10)]

AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC[Orangutan GULOP (Exon10)]

AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC[Macaque GULOP (Exon10)]

When you simply plug in the data (the sequences of each species), phylogenetic software creates a cladogram by looking at the differences between each sequence. What we get is this:

Which matches exactly with hierarchies derived through other completely independent means.

You can read about it in this thread here:

GULO Pseudogene as evidence for common ancestry among primates

The pattern is objectively there. Based solely on data, and not interpretation.

Yes and it shows the different organisms have different base pair sequences in their genome (just as expected) and does not add one iota to the notion that one or the other is "broken", just different for different organisms (as expected). Now just take away the imaginary lines in the picture and we have an actual depiction of the evidence.

 

[46AND2]

Yes and it shows the different organisms have different base pair sequences in their genome (just as expected) and does not add one iota to the notion that one or the other is "broken", just different for different organisms (as expected). Now just take away the imaginary lines in the picture and we have an actual depiction of the evidence.

Is it, or is it not consistent with the hypothesis that it is a broken gene?

 

[pshun2404]

And before you go on about doctored algorithms of the software or some such, just do it yourself.

There are a lot of common bases between all 4 species, so you start there. That's the bottom node in the above picture.

Now, get rid of all the common bases (gasp! ), and start comparing all the letters which differ in at least one of the four.

What is shown is the pattern of differences in the four sequences, regardless of interpretation: is it consistent with god designing it that way? sure (but then, any output could be). Is it consistent with common ancestry? yes (and there are MANY outputs which would not be).

The fact that you (or anyone) would assume these difference equal there being an ancestral creature with a consistent genome from which these all mutated is a huge leap of blind faith. It is just as likely that they are simply different unrelated organisms and that's why the genomes are different.