no evidence for evolution

Originally posted by Morat

Argument by deliberate stupidity is a new one to me.

Click to expand...

You're the one who thinks it's a valid argument to say that shifting bits in ASCII means you get new information from genetic mutations. Seems like you're extremely familiar with argument by deliberate stupidity.

Originally posted by npetreley
Well, everything you say must be reliable because I get TONS of hits for D. Scarlatti. The only problem is that you used to compose music and you're dead.

Click to expand...

Very good. The only problem is Werner Gitt is being presented here as an authority on genetics.

See the difference?

You're the one who thinks it's a valid argument to say that shifting bits in ASCII means you get new information from genetic mutations. Seems like you're extremely familiar with argument by deliberate stupidity.

Click to expand...

Quote me making it, Nicky. Bet you can't.

Just out of curiosity, are you talking about Dawkin's WEASAL program?

Goodness, aren't you a computer guy? Don't you know anything about genetic algorithms? Not the tiny little analogy level one Dawkin's uses, but the real stuff? You know, the kind people use to design circuits, and bridges, and even sort through Scotch barrels in a warehouse.

Don't tell me you've never heard of them. Unless you're just an OS guy.

Originally posted by Morat

Quote me making it, Nicky. Bet you can't.

Click to expand...

Ah, I see you're right. It was Rufus. Sorry.

I take it, therefore, that you disagree with the foremost pre-eminent flawlessly educated population genetics scholar on this point?

On what point? I stated two things:

1) I didn't say what you claimed I said.
2) Dawkins WEASEL program was a good analogy (although it certainly added information according to Shannon) of how mutations add information. Your ludicrous implication that ASCII has anything to do with genetics aside.

I then asked if you were familiar with genetic algorithms. Are you? They're quite useful. I have several books on them. All of them take for granted that mutation and selection on genetic algorithms will result in new information. And, as coding methodology books, they're certainly focused on results.

If it didn't add information, why would anyone use genetic algorithms in programming?

Originally posted by Morat

2) Dawkins WEASEL program was a good analogy (although it certainly added information according to Shannon) of how mutations add information.

Click to expand...

I'll have to check it out someday.

Your ludicrous implication that ASCII has anything to do with genetics aside.

Click to expand...

It wasn't MY ludicrous implication. It was the ludicrous implication of the article to which Rufus linked. Here, see for yourself. It's a side-splitter.

http://www.nmsr.org/nylon.htm

From the article:

So, let us string together several letters to make a "digital" word. The ASCII digital code for the word "bed" is made by stringing together the 7-digit codes for b (1100010), e (1100101), and d (1100100) to make one long code: 110001011001011100100.

...

Here's an example of a frame shift creating information: here, the word "gas" is coded as g(1100111) + a (1100001) + s (1110011). When we apply a Left Frame Shift to the long code for "gas," we do NOT end up with a meaningless phrase such as "q2r." In THIS case, we end up with a new, meaningful word: spy.

...

Certainly, MOST frame shifts will destroy information. BUT NOT ALL - and that is where creationists have it wrong. I have shown three examples where such "Frame Shifts" indeed create new information. After all, in the proper context, the words "spy," "USE," and "dab" actually mean something. Since their meanings are totally unrelated to the original meanings, it is obvious that, at least in this case, the Frame Shift mutation process has created new information.

Click to expand...

Nick,

Do you even understand the genetics of frame shift mutations? The ASCII example is a very good analogy; although, I doubt that you will ever grasp why.

Good lord you're dense. It seems fairly obvious that frame shift mutations can create information, especially if you frame shift non-coding DNA from that example alone.

What's your problem with it?

You're not a programmer, are you?

I'm a programmer, and I think the example makes perfect sense. I've even seen someone write a program designed so that changing the order of the lines of the program always produces a valid program, but each of the programs does different things.

You fool! You've just proven it requires a designer! Hehehehe.

okay npetrely, we'll make it explicit, just for you


genetic code 1:

GCCGTAAGATGATATATCGAATGCCATG

translated:

Ala,Val,Arg,STOP,

Frameshifted Genetic sequence via deletion of bases 2 and 3:

GGTAAGATGATATATCGAATGCCATG:

Gly,Lys,START(met),Ile,Tyr,Arg,Met,Pro....

Wow, we've gone from a stop codon, to a start codon, or methionine. So if this frameshift happened near the C terminal of a gene, the gene is extended beyond its stop codon until it reaches the next one - if this happens in non-coding sequence, we get a start or "initiation" codon. Frameshifts can add "information" - the ascii code demonstration was a perfectly logical way to demonstrate this, but i've made it explicitly genetic, just for you npetrely - I hope you're grateful - i had to look up the genetic code to do this

Originally posted by Morat
You fool! You've just proven it requires a designer! Hehehehe.

Click to expand...

Actually what he proved is that an intelligent designer can design such a system.

Originally posted by chickenman

genetic code 1:

GCCGTAAGATGATATATCGAATGCCATG

translated:

Ala,Val,Arg,STOP,

Frameshifted Genetic sequence via deletion of bases 2 and 3:

GGTAAGATGATATATCGAATGCCATG:

Gly,Lys,START(met),Ile,Tyr,Arg,Met,Pro....

Frameshifts can add "information"

Click to expand...

Maybe my 'rithmetic ain't what it used to be, but it sure looks like you deleted and rearranged information to me.

A change in information still produces new information.

npetrely the problem is that you don't understand translation - I'll spell it out - i've deleted two bases in a DNA sequence, but if they were at the end of an amino acid coding sequence in a gene - in effect you get an addition of several amino acids - the gene has added information, because it no longer stops translating at the stop codon, but keeps adding amino acids to the end of the gene until the next stop codon. So the deletion of bases, and the corresponding frameshift, increases the information content of the gene, becuase the translated proteins C-terminus now contains additional amino acids.

genetic code for the C-terminus of a gene:

....GCCGTAAGATGATATATCGAATGCCATGA:

....Ala,Val,Arg,STOP.

Frameshift caused by deletion of bases 2 and 3;

GGTAAGATGATATATCGAATGCCATGA:

Translated:
Gly,Lys,Met,Ile,Tyr,Arg,Met,Pro,STOP.

so there we go npeterly - a frameshift causing the addition of 6 additional amino acids to the end of a translated protein


An addition of information.

Originally posted by chickenman
npetrely the problem is that you don't understand translation.

Click to expand...

I understand translation just fine, I was just teasing you.

Before I respond, however, I'd like to know: Is this an actual example of a mutation observed in nature? Is it simply a theoretical example of an imagined mutation? Is it a mutation someone manipulated in the lab?

Yes. The mutation that allowed bacteria to digest nylon was a frame-shift mutation.

It was not lab-manipulated, but was easy to track down because unmutated bacteria of that type are fairly common.

From reading the NCBI database about this ability, it appears that there is one nylon-degrading enzyme, EIII aka nylC, that was produced under labratory conditions. I'll try to do some more reading to confirm or deny this.

Edit to add:
I did some more reading and nylC does occur in nature. The mutations that produce it can also occur in labratory conditions. So it appears that for at least nylC, labratory experiments have relpicated its evolution.

P.S. Here is a reference to a review paper.


Negoro S. Biodegradation of nylon oligomers. Appl Microbiol Biotechnol 2000 Oct;54(4):461-6

Abstract:
This mini-review is a compendium of the degradation of a man-made compound, 6-aminohexanoate-oligomer, in flavobacterium strains. The results are summarized as follows:

1. Three enzymes, 6-aminohexanoate-cyclic-dimer hydrolase (EI), 6-aminohexanoate-dimer hydrolase (EII), and endotype 6-aminohexanoate-oligomer hydrolase (EIII) were responsible for degradation of the oligomers.

2. The genes coding these enzymes were located on pOAD2, one of three plasmids harbored in Flavobacterium sp. KI72, which comprised 45,519 bp.

3. The gene coding the EII' protein (a protein having 88% homology with EII) and five IS6100 elements were
identified on pOAD2.

4. The specific activity of EII was 200-fold higher than
that of EII'. However, altering two amino acid residues in the EII' enzyme enhanced the activity of EII' to the same level as that of the EII enzyme.

5.The deduced amino acid sequences from eight regions of pOAD2 had significant imilarity with the sequences of gene products such as oppA-F (encoding oligopeptide permease), ftsX (filamentation temperature sensitivity), penDE (isopenicillin N-acyltransferase) and rep (plasmid replication).

6. The EI and EII genes of Pseudomonas sp. NK87 (another nylon oligomer-degrading bacterium) were also located on plasmids.

7. Through selective cultivation using nylon
oligomers as a sole source of carbon and nitrogen, two strains which initially had no metabolic activity for nylon oligomers, Flavobacterium sp. KI725 and Pseudomonas aeruginosa PAO1, were given the ability to degrade xenobiotic compounds. A molecular basis for the adaptation of microorganisms toward xenobiotic compounds was described.

Bump because I made those edits.