• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

Mutations and Evolution

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Moving along with this thread, it would appear that no one has a real argument against the conclusion that the physical differences between humans and chimps is due to differences between the DNA sequence of their respective genomes. With that in mind . . .

Can anyone show us a single DNA sequence difference between chimps and humans that the known and observed process of mutation could not produce?
 
Upvote 0

mark kennedy

Natura non facit saltum
Site Supporter
Mar 16, 2004
22,030
7,265
63
Indianapolis, IN
✟617,130.00
Gender
Male
Faith
Calvinist
Marital Status
Single
Politics
US-Democrat
Already defined that in the opening post.

"In biology, a mutation is a permanent change of the nucleotide sequence of the genome of an organism, virus, or extrachromosomal DNA or other genetic elements. Mutations result from damage to DNA which is not repaired or to RNA genomes (typically caused by radiation or chemical mutagens), errors in the process of replication, or from the insertion or deletion of segments of DNA by mobile genetic elements.[1][2][3] Mutations may or may not produce discernible changes in the observable characteristics (phenotype) of an organism."
https://en.wikipedia.org/wiki/Mutation

Excellent, that should go a long way to avoid equivocating adaptations with changes in DNA sequences due to transcription errors.

We can get to that in the future. Right now we need to agree on something much simpler.

Are the differences between humans and chimps due to the differences in the DNA sequences of their genome? Yes or no?

That's not even a question, it's more like a given. The extent of the divergence in say, the protein coding genes could be a serious question.

Do you think those differences in protein coding genes are responsible for the physical differences between humans and chimps?

Yes of course, "~29% being identical and the typical orthologue differing by only two amino acids, one per lineage." (Nature 2005)

Why talk about mutations if you can't even agree that changes in DNA sequence will cause any differences?

We must talk about mutations because it's the only way to explain the divergence aside from special and independent creation. I have long contended that the divergence exceeds any reasonable mutation rate when you include the indels and gross structural differences in the protein coding genes:

Taken together, gross structural changes affecting gene products are far more common than previously estimated (20.3% of the PTR22 proteins. (DNA sequence and comparative analysis of chimpanzee chromosome 22, Nature)

I've always thought of you as a true believer, the majority of the trollers haven't a clue and these scientific types know they are putting out shallow misdirections. You on the other hand seem convinced, which is commendable in some ways. The problem is that you spend too much time swimming on the surface. Try a little back ground reading LM, how do the protein coding genes of humans and chimps diverge? Last time I check it was some 40,000 amino acids. Then ask yourself the obvious question, what is the most likely result of an indel in a protein coding gene.

Have a nice day :)
Mark
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Excellent, that should go a long way to avoid equivocating adaptations with changes in DNA sequences due to transcription errors.

Errors in transcription don't change DNA sequences, so I don't see how that would be a problem to begin with.

That's not even a question, it's more like a given.

Just making sure.

Yes of course, "~29% being identical and the typical orthologue differing by only two amino acids, one per lineage." (Nature 2005)

Which means that 30% are 100% identical and the other 70% are about 98-99% identical. Why is this a problem?

We must talk about mutations because it's the only way to explain the divergence aside from special and independent creation. I have long contended that the divergence exceeds any reasonable mutation rate when you include the indels and gross structural differences in the protein coding genes:

Taken together, gross structural changes affecting gene products are far more common than previously estimated (20.3% of the PTR22 proteins. (DNA sequence and comparative analysis of chimpanzee chromosome 22, Nature)

I am waiting for you to show that it is unreasonable.

Let's look at that study a bit closer, shall we?

"Here, we report the high-quality DNA sequence of 33.3 megabases of chimpanzee chromosome 22. By comparing the whole sequence with the human counterpart, chromosome 21, we found that 1.44% of the chromosome consists of single-base substitutions in addition to nearly 68,000 insertions or deletions."

1.44% of 33.3 MB is ~480,000 substitution mutations. They also report 68,000 indels. Again, substitution mutations are much more common than indels, and don't cause frame shifts.

"In contrast, 47 PTR22q genes show significant structural changes affecting at least one of their transcript isoforms. Fifteen genes have indels within their coding region yet retain frame consistency in all but one case (TCP10L) (Supplementary Table 4)."

So we only have one gene that has a frame shift mutation due to an indel, and 14 genes that have an indel but no frame shift mutation. Also, not all of the "structural changes" were indels.

I've always thought of you as a true believer, the majority of the trollers haven't a clue and these scientific types know they are putting out shallow misdirections. You on the other hand seem convinced, which is commendable in some ways. The problem is that you spend too much time swimming on the surface. Try a little back ground reading LM, how do the protein coding genes of humans and chimps diverge? Last time I check it was some 40,000 amino acids. Then ask yourself the obvious question, what is the most likely result of an indel in a protein coding gene.

The most likely result of an indel in a protein coding gene is a frame shift mutation which would most likely be selected against and removed from the population. However, all indels that are multiples of 3 will not result in a frame shift mutation.

On the flip side, substitution mutations are 7 times more common than indels and they don't cause frame shift mutations. You always seem to forget that.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
There seems to be some confusion in other threads as to what mutations are and what causes them. There is even one poster who thinks that mutations will not occur in genes if there is no horizontal genetic transfer or junk DNA. Strange, I know. The opening post gives the formal definition of what a mutation is. I thought I would give some specific examples (mutations in red)

Substitution mutation:

ATGTTGTATGATCCTCATA
ATGTTGTACGATCCTCATA

insertion/deletion (i.e. indel):

ATGTTGTATGA--TCCTCATA
ATGTTGTATGAGGTCCTCATA

Contrary to what some people claim, these are not caused by transposons, epigenetics, or horizontal genetic transfer.
 
Upvote 0

mark kennedy

Natura non facit saltum
Site Supporter
Mar 16, 2004
22,030
7,265
63
Indianapolis, IN
✟617,130.00
Gender
Male
Faith
Calvinist
Marital Status
Single
Politics
US-Democrat
Errors in transcription don't change DNA sequences, so I don't see how that would be a problem to begin with.

It is amazing how many fundamental errors you make in a row. An error during transcription is the source of Genetic mutations:

DNA Transcription

In the living cell, DNA undergoes frequent chemical change, especially when it is being replicated (in S phase of the eukaryotic cell cycle). Most of these changes are quickly repaired. Those that are not result in a mutation. Thus, mutation is a failure of DNA repair.

Mutations



Which means that 30% are 100% identical and the other 70% are about 98-99% identical. Why is this a problem?

The deleterious effect of mutations on protein coding genes. Of course if you never bother to learn basic genetics that would not effect your understanding one bit and you obviously are not interested.



"Here, we report the high-quality DNA sequence of 33.3 megabases of chimpanzee chromosome 22. By comparing the whole sequence with the human counterpart, chromosome 21, we found that 1.44% of the chromosome consists of single-base substitutions in addition to nearly 68,000 insertions or deletions."

1.44% of 33.3 MB is ~480,000 substitution mutations. They also report 68,000 indels. Again, substitution mutations are much more common than indels, and don't cause frame shifts.

Here's the quote in context:

By comparing the whole sequence with the human counterpart, chromosome 21, we found that 1.44% of the chromosome consists of single-base substitutions in addition to nearly 68,000 insertions or deletions. These differences are sufficient to generate changes in most of the proteins. Indeed, 83% of the 231 coding sequences, including functionally important genes, show differences at the amino acid sequence level​

That's 83% of the protein coding genes with 20% showing gross structural differences.

Estimates of nucleotide substitution rates of aligned sequences range from 1.23% by bacterial artificial chromosome (BAC) end sequencing to about 2% by molecular analysis, whereas the overall sequence difference was estimated to be approximately 5% by taking regions of insertions or deletions (indels) into account​

In other words, it's between 1% and 2% when you count just single base substitutions (differences). If you count those of length, and some of them are millions of base pairs genome wide, it's 5% at least. Your just going to sit there and say so what?

"In contrast, 47 PTR22q genes show significant structural changes affecting at least one of their transcript isoforms. Fifteen genes have indels within their coding region yet retain frame consistency in all but one case (TCP10L) (Supplementary Table 4)."

So we only have one gene that has a frame shift mutation due to an indel, and 14 genes that have an indel but no frame shift mutation. Also, not all of the "structural changes" were indels.

You forget, the explanation for the difference is mutations. Ultimately they are just differences that assume indels as the cause. Of course there wouldn't be frame shifts if the lineages were independently created.



The most likely result of an index in a protein coding gene is a frame shift mutation which would most likely be selected against and removed from the population. However, all indels that are multiples of 3 will not result in a frame shift mutation.

Which assumes two things, one that the three are an actual amino acid, there are only 22. It also assumes that the sequence will fold into a useful, functional protein.

On the flip side, substitution mutations are 7 times more common than indels and they don't cause frame shift mutations. You always seem to forget that.

No, the most likely result of a single base substitution isn't a frame shifts, it's more likely a
Missense mutation (Sickle Cell), Nonsense mutation (Cystic Fibrosis), Silent mutations (Don't effect product), Splice-site mutations (Loss of an intron). Your problem is that after all these years you still haven't leaned basic biology and genetics
 
Upvote 0

[serious]

'As we treat the least of our brothers...' RIP GA
Site Supporter
Aug 29, 2006
15,100
1,716
✟117,846.00
Faith
Non-Denom
Marital Status
Married
It is amazing how many fundamental errors you make in a row. An error during transcription is the source of Genetic mutations:

DNA Transcription

In the living cell, DNA undergoes frequent chemical change, especially when it is being replicated (in S phase of the eukaryotic cell cycle). Most of these changes are quickly repaired. Those that are not result in a mutation. Thus, mutation is a failure of DNA repair.

Mutations





The deleterious effect of mutations on protein coding genes. Of course if you never bother to learn basic genetics that would not effect your understanding one bit and you obviously are not interested.





Here's the quote in context:

By comparing the whole sequence with the human counterpart, chromosome 21, we found that 1.44% of the chromosome consists of single-base substitutions in addition to nearly 68,000 insertions or deletions. These differences are sufficient to generate changes in most of the proteins. Indeed, 83% of the 231 coding sequences, including functionally important genes, show differences at the amino acid sequence level​

That's 83% of the protein coding genes with 20% showing gross structural differences.

Estimates of nucleotide substitution rates of aligned sequences range from 1.23% by bacterial artificial chromosome (BAC) end sequencing to about 2% by molecular analysis, whereas the overall sequence difference was estimated to be approximately 5% by taking regions of insertions or deletions (indels) into account​

In other words, it's between 1% and 2% when you count just single base substitutions (differences). If you count those of length, and some of them are millions of base pairs genome wide, it's 5% at least. Your just going to sit there and say so what?



You forget, the explanation for the difference is mutations. Ultimately they are just differences that assume indels as the cause. Of course there wouldn't be frame shifts if the lineages were independently created.





Which assumes two things, one that the three are an actual amino acid, there are only 22. It also assumes that the sequence will fold into a useful, functional protein.



No, the most likely result of a single base substitution isn't a frame shifts, it's more likely a
Missense mutation (Sickle Cell), Nonsense mutation (Cystic Fibrosis), Silent mutations (Don't effect product), Splice-site mutations (Loss of an intron). Your problem is that after all these years you still haven't leaned basic biology and genetics
You might want to read your own links. Mutations are from errors in dna replication (dna copied to dna). Transcription is the process of voting dna to rna. Any errors here wouldn't end up in the genome since we aren't making any dna in transcription.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
It is amazing how many fundamental errors you make in a row. An error during transcription is the source of Genetic mutations:

DNA Transcription

In the living cell, DNA undergoes frequent chemical change, especially when it is being replicated (in S phase of the eukaryotic cell cycle). Most of these changes are quickly repaired. Those that are not result in a mutation. Thus, mutation is a failure of DNA repair.

That would be a failure in DNA repair, not gene transcription. Nothing in your reference supports what you are claiming.

The deleterious effect of mutations on protein coding genes. Of course if you never bother to learn basic genetics that would not effect your understanding one bit and you obviously are not interested.

If changes in sequence are always deleterious, then how can chimps survive with 70% of their proteins being different from humans? The fact that genes are different in other species and those species flourish with those changes disproves the ridiculous claim that mutations are always deleterious.

In other words, it's between 1% and 2% when you count just single base substitutions (differences). If you count those of length, and some of them are millions of base pairs genome wide, it's 5% at least. Your just going to sit there and say so what?

Both species appear to be doing just fine. As the old saying goes, the proof of the pudding is in the eating. The health and success of the great ape and human lineages proves that these changes are not problematic.

Also, there are more differences between the chimp and gorilla genomes than there is the chimp and human genome. How is it that two apes can differ more than an ape and a human?

You forget, the explanation for the difference is mutations. Ultimately they are just differences that assume indels as the cause. Of course there wouldn't be frame shifts if the lineages were independently created.

Indel is the name of the difference. They cause a difference in the amino acid sequence even if we assume they were independently created. Also, not all indels cause frame shifts. Indels that are a factor of 3 will not cause a frame shift. Also, frame shifts do not bridge exons.

Which assumes two things, one that the three are an actual amino acid, there are only 22. It also assumes that the sequence will fold into a useful, functional protein.

You are talking nonsense. If you take 3 bases out all you do is take one amino acid out of the resulting protein. The next codon is still in frame. If you take 6 bases you take out 2 codons, 9 bases are 3 codons, and so forth. Here is a short sequence for you to consider.

atgtcctgggggcccggctaa
M--S--W--G--P--G--stp

Take out 3 bases (the tcc towards the start)

atgtgggggcccggctaa
M--W--G--P--G--stp


Not all indels result in a frame shift mutation.


No, the most likely result of a single base substitution isn't a frame shifts, it's more likely a
Missense mutation (Sickle Cell), Nonsense mutation (Cystic Fibrosis), Silent mutations (Don't effect product), Splice-site mutations (Loss of an intron). Your problem is that after all these years you still haven't leaned basic biology and genetics

What disease does the frame shift mutations in the human GULO gene cause in humans?
 
Upvote 0