Journal of Creation papers

[Aggie]

Tomkins, for some reason, keeps getting results that can't be replicated by anyone other than him. Given his blatant dishonesty with calculating indels as 100 separate differences rather than a single difference so he could arrive at a 70% difference between humans and chimps, I suspect he's driven by agenda.

A Google search for "Tomkins+GULO" got three hits from non-Creationist sites including a subreddit where Tomkins addressed the post and then simply slunk away.
http://www.reddit.com/r/NaturalTheology/comments/2625uu/my_first_reply_to_jeffrey_tomkins/

Thanks, that's useful. If I'm going to discuss this in a book, though, I don't think it's enough to just say that someone on Reddit did the same analysis and got a different result. What I'd really like to know is what error Tomkins made, and how that produced the result he got. Has anyone figured that out?

 

[Loudmouth]

Thanks, that's useful. If I'm going to discuss this in a book, though, I don't think it's enough to just say that someone on Reddit did the same analysis and got a different result. What I'd really like to know is what error Tomkins made, and how that produced the result he got. Has anyone figured that out?

It is enough to show that he used an ungapped analysis. You could mention that there was some question about minor bugs in the BLAST algorithm that could have caused smaller adjustments up or down from the reported values, but using an ungapped comparison invalidates the main argument from the get go. It is a rather easy thing to show if you are interested in using an illustration. For example:

ungapped comparison with a single one base indel:

CATCGAGAAACAAGGCATTCCGGGCTGAA
CATCGAGAAACAAGGCAGTTCCGGGCTGAA
22/30 match

Gapped comparison of same sequences

CATCGAGAAACAAGGCA-TTCCGGGCTGAA
CATCGAGAAACAAGGCAGTTCCGGGCTGAA
29/30 match

 

[sfs]

Thanks, that's useful. If I'm going to discuss this in a book, though, I don't think it's enough to just say that someone on Reddit did the same analysis and got a different result. What I'd really like to know is what error Tomkins made, and how that produced the result he got. Has anyone figured that out?

Which result are you asking about? From my quick skim of the paper, it seemed that Tomkins was tossing quite a bit of chaff about.

 

[Aggie]

It is enough to show that he used an ungapped analysis. You could mention that there was some question about minor bugs in the BLAST algorithm that could have caused smaller adjustments up or down from the reported values, but using an ungapped comparison invalidates the main argument from the get go. It is a rather easy thing to show if you are interested in using an illustration. For example:

ungapped comparison with a single one base indel:

CATCGAGAAACAAGGCATTCCGGGCTGAA
CATCGAGAAACAAGGCAGTTCCGGGCTGAA
22/30 match

Gapped comparison of same sequences

CATCGAGAAACAAGGCA-TTCCGGGCTGAA
CATCGAGAAACAAGGCAGTTCCGGGCTGAA
29/30 match

Yes, I understand the problem with using an ungapped comparison. I've actually made my own image along these lines that I'll be using in the book.

Which result are you asking about? From my quick skim of the paper, it seemed that Tomkins was tossing quite a bit of chaff about.

The main thing I'm wondering about is his conclusion that the GULO pseudogene is more similar between humans and gorillas than it is between humans and chimpanzees. Even if he used a method that inflated the size of the genetic differences, I'd assume it would inflate them about the same amount in both cases, so that the human and chimpanzee pseudogenes should still be the most similar to one another. Do you know what the explanation is for why he found the greatest similarity between humans and gorillas?

 

[sfs]

The main thing I'm wondering about is his conclusion that the GULO pseudogene is more similar between humans and gorillas than it is between humans and chimpanzees. Even if he used a method that inflated the size of the genetic differences, I'd assume it would inflate them about the same amount in both cases, so that the human and chimpanzee pseudogenes should still be the most similar to one another. Do you know what the explanation is for why he found the greatest similarity between humans and gorillas?

It's hard to guess exactly why he got the answer he did. A couple of possibilities suggest themselves. First, if he was using the buggy version of BLAST, the effect was not small: my sequence similarity dropped a lot when I hit the bug, by much more that the actual sequence differences between humans and chimps or gorillas (and by much more than the difference between those differences). Since the missing matches were effectively random (i.e. I have no idea why some were lost), that's equivalent to injecting lots of noise into the comparison. Even in the absence of the bug, his metric of similarity is funky enough that it probably has much larger variance than more appropriate techniques. Thus the two comparisons might well not scale uniformly.

Second, he's not using a standard approach to constructing the phylogeny: he's defining his interspecies distance as the overall genetic dissimilarity, rather than by the number of character differences (i.e. mutations) separating the species. Instead of doing something like maximum parsimony, he's just counting how many bases match (using his flawed metric). A single moderate insertion or deletion could change the number of bases by a lot. In fact, a single deletion could easily make two human chromosomes look more distantly related than a human and a chimpanzee chromosome, and such deletions are common. It's just incredibly bad approach to use if you want to recover evolutionary relationships, which is what he's supposed to be doing.

By the way, I checked with a reference librarian at the university where I'm affiliated for that dino-bird paper, and he could not find a copy online. I can put in an Interlibrary Loan request, but have to wait until my ILL registration goes through. (Hopefully I won't have any problems -- I'm a visiting scientist/associate here, and not faculty or staff, but my library privileges haven't failed me yet.)

 

[Aggie]

By the way, I checked with a reference librarian at the university where I'm affiliated for that dino-bird paper, and he could not find a copy online. I can put in an Interlibrary Loan request, but have to wait until my ILL registration goes through. (Hopefully I won't have any problems -- I'm a visiting scientist/associate here, and not faculty or staff, but my library privileges haven't failed me yet.)

Thanks a lot if you're willing to go to that much trouble. I wouldn't have requested that someone do so much work to try and find the paper, but I certainly appreciate it if you're offering that.

If you can manage to find it, could you please e-mail it to me? I think you have my e-mail address.

 

[sfs]

Thanks a lot if you're willing to go to that much trouble. I wouldn't have requested that someone do so much work to try and find the paper, but I certainly appreciate it if you're offering that.

If you can manage to find it, could you please e-mail it to me? I think you have my e-mail address.

Not really much of a bother: the library was on my way across campus, and I enjoy seeing if I can tap the mighty resources of academia. I'll let you know if anything arrives -- it will probably be a couple of weeks.

 

[RickG]

I'm not sure you understand the point I'm making. In order to answer the other side's arguments in any debate, it's necessary to first understand the arguments they're making. These journals are where the most important creationist arguments are published. If we don't read them, we won't know what arguments are made there, and we'll end up making mistakes like responding to an argument that creationists stopped using 30 years ago.

I understand what you are trying to do, however; I think the most important thing to understand is that the Creation Science literature is not targeted for the scientific community, rather the minions hearing what they want to hear who couldn't fact check their claims even if they wanted to, and those who could deliberately will no.

Another thing to understand is that none of those people, even those who possess a particular scientific background, do not perform research (ha, ha), in the academic field they criticize, and none of their peer reviewers come even close to being qualified to being legitimate reviewers.

 

[Aggie]

Another thing to understand is that none of those people, even those who possess a particular scientific background, do not perform research (ha, ha), in the academic field they criticize

I'm pretty sure this isn't true. Robert Gentry is best-known for his creationist arguments about physics, but he's also written non-creationist physics papers that were published in the mainstream journals Nature and Science. In Andrew Snelling's case, there's a page here that criticizes him for writing peer-reviewed geology papers that involve ages in the millions of years, while at the same time writing creationist papers that argue the world is only six thousand years old. Snelling's response to this, although I can't find the URL of it at the moment, is that his mainstream papers use these ages because that's what other professional geologists expect from him. He's able to write and work from the mainstream perspective; he just doesn't believe it himself.

I mentioned RATE as the most important set of creationist arguments about radiometric dating, and they're a good example of what I'm trying to do. Even though the main RATE books are meant more for creationists than for mainstream scientists, nearly every creationist book and paper creationists have written about radiometrics in the past decade has relied heavily on RATE's results. I think it's most effective to deal with these sorts of arguments at their source.

 

[RickG]

I'm pretty sure this isn't true. Robert Gentry is best-known for his creationist arguments about physics, but he's also written non-creationist physics papers that were published in the mainstream journals Nature and Science. In Andrew Snelling's case, there's a page here that criticizes him for writing peer-reviewed geology papers that involve ages in the millions of years, while at the same time writing creationist papers that argue the world is only six thousand years old. Snelling's response to this, although I can't find the URL of it at the moment, is that his mainstream papers use these ages because that's what other professional geologists expect from him. He's able to write and work from the mainstream perspective; he just doesn't believe it himself.

I mentioned RATE as the most important set of creationist arguments about radiometric dating, and they're a good example of what I'm trying to do. Even though the main RATE books are meant more for creationi sts than for mainstream scientists, nearly every creationist book and paper creationists have written about radiometrics in the past decade has relied heavily on RATE's results. I think it's most effective to deal with these sorts of arguments at their source.

There's an interesting thing about Gentry that I ran across several years ago but cannot find the source again. Gentry was actually on a team at Oak Ridge Nuclear Laboratory investigating a way to accelerate radioactive decay rates. The idea of course was to neutralize nuclear waste. The team concluded it could not be done.

 

[Loudmouth]

I'm pretty sure this isn't true. Robert Gentry is best-known for his creationist arguments about physics, but he's also written non-creationist physics papers that were published in the mainstream journals Nature and Science.

He is known for his radiohalos which he claims are found in rocks that were created suddenly during the creation week. The problem for Gentry is that these rocks intrude into sediments that carry fossils which would require God to also plant fake fossils.
http://paleo.cc/ce/halos.htm

In Andrew Snelling's case, there's a page here that criticizes him for writing peer-reviewed geology papers that involve ages in the millions of years, while at the same time writing creationist papers that argue the world is only six thousand years old. Snelling's response to this, although I can't find the URL of it at the moment, is that his mainstream papers use these ages because that's what other professional geologists expect from him. He's able to write and work from the mainstream perspective; he just doesn't believe it himself.

That is the least of his crimes. He does whole rock analyses on rocks that are known to have xenoliths which is completely inappropriate.

http://www.icr.org/research/index/researchp_as_r01/

He should know that using samples with xenoliths are not appropriate for dating the actual date of the eruption, yet he does it anyway.

"Steiner [90] stressed that xenoliths are a common constituent of the 1954 Ngauruhoe lava, but also noted that Battey [7] reported the 1949 Ngauruhoe lava was rich in xenoliths. All samples in this study contained xenoliths, including those from the 1975 avalanche material."
http://www.icr.org/research/index/researchp_as_r01/

 

[RickG]

That is the least of his crimes. He does whole rock analyses on rocks that are known to have xenoliths which is completely inappropriate.

http://www.icr.org/research/index/researchp_as_r01/

He should know that using samples with xenoliths are not appropriate for dating the actual date of the eruption, yet he does it anyway.

"Steiner [90] stressed that xenoliths are a common constituent of the 1954 Ngauruhoe lava, but also noted that Battey [7] reported the 1949 Ngauruhoe lava was rich in xenoliths. All samples in this study contained xenoliths, including those from the 1975 avalanche material."
http://www.icr.org/research/index/researchp_as_r01/

Thus, intellectual dishonesty, the very thing that causes "honest" Christians to question Christianity.

 

[SkyWriting]

I also could try contacting the paper's authors, but I doubt they'd be interested in cooperating once they realize that I'm not a creationist.

That's an unfounded criticism. If you don't start with "Hello DimWit" then I'm sure they would cooperate.

Call your local library. They usually have a way for you
to access other libraries that is limited to your request.
Christian universities may have it available.

 

[Aggie]

There's an interesting thing about Gentry that I ran across several years ago but cannot find the source again. Gentry was actually on a team at Oak Ridge Nuclear Laboratory investigating a way to accelerate radioactive decay rates. The idea of course was to neutralize nuclear waste. The team concluded it could not be done.

If you can find that source for that, I'd appreciate seeing it.

That's an unfounded criticism. If you don't start with "Hello DimWit" then I'm sure they would cooperate.

I e-mailed Jerry Bergman a week ago politely asking for the paper, but he never replied to me. I didn't mention in my e-mail that I'm not a creationist, but I suspect he figured it out, and that he wasn't interested in sharing the paper with someone whose interest in it was for the purpose of criticizing it.

However, I have the paper now, because sfs just sent it to me less than an hour ago. Sfs, thanks for going to the trouble of doing that.

 

[RickG]

If you can find that source for that, I'd appreciate seeing it.


I e-mailed Jerry Bergman a week ago politely asking for the paper, but he never replied to me. I didn't mention in my e-mail that I'm not a creationist, but I suspect he figured it out, and that he wasn't interested in sharing the paper with someone whose interest in it was for the purpose of criticizing it.

However, I have the paper now, because sfs just sent it to me less than an hour ago. Sfs, thanks for going to the trouble of doing that.

Here's a link Aggie, but I'm not sure if it is the one I was thinking of.
http://www.talkorigins.org/faqs/po-halos/gentry.html

On another note, I remember a youtube debate between Hugh Ross and Kent Hovind where Hovind threatened to leave. I don't remember the exact topic, but it was one which Ross brought up and Hovind stated that they have agreed not to discuss that topic before the debate. That kind of gives an insight as to why creationists are seldom seen in "honest open" debates. I wonder what Nye had to agree not to discuss for his debate with Ham to occur?

 

[Aggie]

Here's a link Aggie, but I'm not sure if it is the one I was thinking of.
http://www.talkorigins.org/faqs/po-halos/gentry.html

Thanks, but the research discussed there doesn't seem to have been about ways to accelerate nuclear decay. It looks like it was about possible ways to encase radioactive nuclear waste in synthetic crystal. Is that what you were thinking of, or did he try to research accelerated decay as well?

 

[RickG]

Thanks, but the research discussed there doesn't seem to have been about ways to accelerate nuclear decay. It looks like it was about possible ways to encase radioactive nuclear waste in synthetic crystal. Is that what you were thinking of, or did he try to research accelerated decay as well?

I'm not sure, it has been several years since I remember reading about it. That may have been the source I was talking about or it may not have been. It seems that I remember something about attempting to accelerate nuclear decay but I may be mistaken. Come to think of it, wouldn't accelerating nuclear decay be more of a problem, i.e., more heat and radiation?

 

[Aggie]

Come to think of it, wouldn't accelerating nuclear decay be more of a problem, i.e., more heat and radiation?

It would be if you were to do it over a large area, but it seems like it would be useful as a way to neutralize individual barrels of nuclear waste, as long as they're properly contained.

 

[Subduction Zone]

I'm not sure, it has been several years since I remember reading about it. That may have been the source I was talking about or it may not have been. It seems that I remember something about attempting to accelerate nuclear decay but I may be mistaken. Come to think of it, wouldn't accelerating nuclear decay be more of a problem, i.e., more heat and radiation?

If it could be done in a contained environment that heat could be harvested. It could be used to boil water that is used to spin turbines. The reason why radioactive waste is "waste" is because it does not release energy quickly enough to be of any use.

But as you said they found that there was no way to change the rates of radioactive decay that would have made much of a difference at all.

I seem to remember one element where they did appreciable raise the rate of beta decay. But to do so they had to strip it of all electrons. And that is an energy absorbing, not an energy releasing reaction. It would also never be found anywhere naturally occurring on or in the Earth.

 

[SkyWriting]

I e-mailed Jerry Bergman a week ago politely asking for the paper, but he never replied to me. I didn't mention in my e-mail that I'm not a creationist, but I suspect he figured it out, and that he wasn't interested in sharing the paper with someone whose interest in it was for the purpose of criticizing it.

Your bias is sloppy all over that account.
You're just dripping with the urge to condemn
and fill in the voids with your imagination.
You have absolutely no reason to be critical
of his failure to answer.