I need some help from the YEC's on this board

[crawfish]

This is getting pointless fast.

Kind regards

r035198x

This post needs to be copied and pasted quite liberally around here.

 

[metherion]

Shenren-

About the information thing.

Information and thermodynamic entropy are actually closely related, but information is an easily equivocal-able word.

Here’s the wiki article if you don’t want to read / want clarification on my summary.
Entropy (information theory) - Wikipedia, the free encyclopedia
Entropy in thermodynamics and information theory - Wikipedia, the free encyclopedia

Pretty much, the amount of information contained in something is the number of possible states it could be in.

I really don’t get how the units work, so the number are contrived, probably wrong, but should serve as an example.

Take a hydrogen atom at room temperature. We’ll say it has an information value of 1. But heat it up enough that the electron could jump orbitals (n=1 to n=2, say), and all of a sudden the information content increases to 2, because you could have it at n=1 OR n=2. The number of possible states for it has increased. It could possibly be either 3 or 4, because of the combo of spin numbers and energy levels it could be in. And when it cools back down, that electron loses the energy to jump, so the information content decreases back down to 1.

So the ‘information’ contained in a textbook isn’t equivalent to thermodynamic information. The 'information' in two books might be equal if the total number of atoms/electrons/whatever between the paper, binding blue, cover, ink, etc is the same regardless of what is written, if I understand it right.

So, according to your first question,

How much information is there in two hydrogen atoms?

It would probably wind up being twice that of one hydrogen atom at the same temp. I *think* it’s measured in bits, but I could be way off. I haven’t had actual classes in entropy and its relation to information theory like I have in thermodynamics

And the energy in macroscopic things would be HUGE because of hose many individual atoms, electrons, energy levels, etc would need to be described.

Metherion

 

[shernren]

Yup, it's S (classical entropy) = k_B S (informational entropy). That's why rcorlew's posts strike me as confused, because while there is a link between thermodynamics and information theory it doesn't specify any kind of conserved quantity - entropy can be both created and (locally) destroyed from nothing.

 

[rcorlew]

Shenren-

About the information thing.

Information and thermodynamic entropy are actually closely related, but information is an easily equivocal-able word.

Here’s the wiki article if you don’t want to read / want clarification on my summary.
Entropy (information theory) - Wikipedia, the free encyclopedia
Entropy in thermodynamics and information theory - Wikipedia, the free encyclopedia

Pretty much, the amount of information contained in something is the number of possible states it could be in.

I really don’t get how the units work, so the number are contrived, probably wrong, but should serve as an example.

Take a hydrogen atom at room temperature. We’ll say it has an information value of 1. But heat it up enough that the electron could jump orbitals (n=1 to n=2, say), and all of a sudden the information content increases to 2, because you could have it at n=1 OR n=2. The number of possible states for it has increased. It could possibly be either 3 or 4, because of the combo of spin numbers and energy levels it could be in. And when it cools back down, that electron loses the energy to jump, so the information content decreases back down to 1.

So the ‘information’ contained in a textbook isn’t equivalent to thermodynamic information. The 'information' in two books might be equal if the total number of atoms/electrons/whatever between the paper, binding blue, cover, ink, etc is the same regardless of what is written, if I understand it right.

So, according to your first question,


It would probably wind up being twice that of one hydrogen atom at the same temp. I *think* it’s measured in bits, but I could be way off. I haven’t had actual classes in entropy and its relation to information theory like I have in thermodynamics

And the energy in macroscopic things would be HUGE because of hose many individual atoms, electrons, energy levels, etc would need to be described.

Metherion

Yes, that is the information that is referenced in the conservation of information. Look at a tree, it has tons of information from its size, shape of all its leaves, the individual specks of bark, all the way down to the relation to each individual atom to each other. You can cut down that and make many things out of it, you can burn it, whatever you like, but every bit of information that the tree possessed is still there somewhere. It can be heat energy, being used as a coffee table (I could use a cup now), mulch for the flower beds around your house and so on.

Even more so, you could define the tree by all the information that went into it (sun, nutrients, water, wind and all of the other variables) It is like the apparent randomness of tossing a coin, it is not random at all, if you knew the angle of the toss, the wind direction speed, height above the ground, altitude, air density, temperature, as well as many other factors, you could accurately predict a heads or tails. All of the variables that act on the coin are the result of something else, much the same as all of the variables acting on a seed for that old oak tree.

Life is all about information, starting from the atomic/sub-atomic, growing into the molecular, and then to organic and non-organic compounds. The idea is pretty complex, which I guess is why we talked about off and on for half of our class. It is very interesting to trace items back to their origin.

It is very much like evolutionary biology, you can see that organism B has much of the same information in its genome as organism A so you hypothesize they must somehow be related. You construct an experiment to falsify or validate your hypothesis, but you already see the information chain from one organism to another.

 

[shernren]

Even more so, you could define the tree by all the information that went into it (sun, nutrients, water, wind and all of the other variables) It is like the apparent randomness of tossing a coin, it is not random at all, if you knew the angle of the toss, the wind direction speed, height above the ground, altitude, air density, temperature, as well as many other factors, you could accurately predict a heads or tails. All of the variables that act on the coin are the result of something else, much the same as all of the variables acting on a seed for that old oak tree.

Replace "tree" by "person" and suddenly you're in a whole world of philosophical trouble.

 

[Papias]

Again, it is worth pointing out, that even if we take the thermodynamic approach of using "entropy" to mean "information" (even though this is not what is meant in common speech), rcorlew's "conservation of information" does not work.

This is because, as shernren pointed out, entropy is both created and destroyed, and it is explicitly NOT conserved. In fact, according to the second law of thermodynamics, entropy is continually INCREASING in the universe.

rcorlew wrote:

Yes, that is the information that is referenced in the conservation of information. Look at a tree, it has tons of information from its size, shape of all its leaves, the individual specks of bark, all the way down to the relation to each individual atom to each other. You can cut down that and make many things out of it, you can burn it, whatever you like, but every bit of information that the tree possessed is still there somewhere. It can be heat energy, being used as a coffee table (I could use a cup now), mulch for the flower beds around your house and so on.

This shows that you not only don't understand your own argument, but that you don't understand basic chemistry. Entropy is important in all of those changes specifically because it changes the number of possible states - in other words, entropy is not conserved, especially not in reactions, where we use that in the calculations. I've been doing thermodynamics calculations including entropy for 25 years. Rcorlew, have you?


Lastly, now that rcorlew is back, here are the questions I asked him on the earlier post, which he apparently has ignored:

Now, let me ask you again, directly - are you simply arguing for Dembski's idea? Did your "weeks of study" involve reading Dembski, or do you have real source for this that is relevant to biology?

Also, we are still waiting for your response to Shernren's example of erasing a hard disk - was the information conserved?

Papias

 

[rcorlew]

Again, it is worth pointing out, that even if we take the thermodynamic approach of using "entropy" to mean "information" (even though this is not what is meant in common speech), rcorlew's "conservation of information" does not work.

This is because, as shernren pointed out, entropy is both created and destroyed, and it is explicitly NOT conserved. In fact, according to the second law of thermodynamics, entropy is continually INCREASING in the universe.

rcorlew wrote:


This shows that you not only don't understand your own argument, but that you don't understand basic chemistry. Entropy is important in all of those changes specifically because it changes the number of possible states - in other words, entropy is not conserved, especially not in reactions, where we use that in the calculations. I've been doing thermodynamics calculations including entropy for 25 years. Rcorlew, have you?


Lastly, now that rcorlew is back, here are the questions I asked him on the earlier post, which he apparently has ignored:

Now, let me ask you again, directly - are you simply arguing for Dembski's idea? Did your "weeks of study" involve reading Dembski, or do you have real source for this that is relevant to biology?

Also, we are still waiting for your response to Shernren's example of erasing a hard disk - was the information conserved?

Papias

OK, you clearly have absolutely no idea what yo are talking about at this point so I would suggest you at least study this theory, it is not a theory of my own creation. The conservation of information is not a reference to books, but involves every aspect of the physical universe.

Question for you, let us say you make a simple solution of NACL and H2O, what happens when both items are mixed together? Do any of the original reactants become reduced or increased upon this reaction/mixing? What if I drank some of the product, have any of the original reactants increased or decreased, can we still trace all of the flow of the product and relate it back to the original reactants?

 

[Papias]

rcorlew wrote:

Question for you, let us say you make a simple solution of NACL and H2O, what happens when both items are mixed together? Do any of the original reactants become reduced or increased upon this reaction/mixing? What if I drank some of the product, have any of the original reactants increased or decreased, can we still trace all of the flow of the product and relate it back to the original reactants?

I will answer your question, hoping that you will now answer mine at the end of this post. First, what you have described is generally referred to as a dissolution, not usually a reaction, as no electron configurations have changed. Second, please learn about basic chemical notation, because basic errors like yours hurt my eyes. Third, I think you are pointing out that each of the original atoms is conserved, thus showing the conservation of matter. Information is not conserved, matter is. Yes, we can trace each atom back.

OK, you clearly have absolutely no idea what yo are talking about at this point so I would suggest you at least study this theory, it is not a theory of my own creation.

OK, fine - I've yet to see you describe how the information approach to entropy shows your dembski conservation of information. All you've done is post example after example that shows the conservation of matter, apparently without the understanding that matter is not information. Secondly, you appear to be confusing the scientific terms of "theory" and "law". There is a "law" of the conservation of matter. I've looked into your links, and even to the links that metherion so generously posted, and they don't appear to relate to, or even support, what you are saying.

Which brings us back to the three questions that you've ignored for yet another post now:


1. are you simply arguing for Dembski's idea?
2. Did your "weeks of study" involve reading Dembski, or do you have real source for this that is relevant to biology?

3. Also, we are still waiting for your response to Shernren's example of erasing a hard disk - was the information conserved?

4. Rcorlew, for how many years have you been doing thermodynamics calculations involving entropy?

Papias

 

[rcorlew]

rcorlew wrote:


I will answer your question, hoping that you will now answer mine at the end of this post. First, what you have described is generally referred to as a dissolution, not usually a reaction, as no electron configurations have changed. Second, please learn about basic chemical notation, because basic errors like yours hurt my eyes. Third, I think you are pointing out that each of the original atoms is conserved, thus showing the conservation of matter. Information is not conserved, matter is. Yes, we can trace each atom back.



OK, fine - I've yet to see you describe how the information approach to entropy shows your dembski conservation of information. All you've done is post example after example that shows the conservation of matter, apparently without the understanding that matter is not information. Secondly, you appear to be confusing the scientific terms of "theory" and "law". There is a "law" of the conservation of matter. I've looked into your links, and even to the links that metherion so generously posted, and they don't appear to relate to, or even support, what you are saying.

Which brings us back to the three questions that you've ignored for yet another post now:


1. are you simply arguing for Dembski's idea?
2. Did your "weeks of study" involve reading Dembski, or do you have real source for this that is relevant to biology?

3. Also, we are still waiting for your response to Shernren's example of erasing a hard disk - was the information conserved?

4. Rcorlew, for how many years have you been doing thermodynamics calculations involving entropy?

Papias

It was not I who made that post/claim, I have no clue who this guy/gal is so I cannot comment on their claim(s).

Added later --->>> I just went back and found that you are the one who brought up Dembski in post #46

So, again here we are, you have absolutely no idea what the conservation of information is (physics), who has said what, and are acting a bit YECish at this point. So it would do you well to take some of the TE advice and go study what it is that you are talking about before posting any further.

The only answer that I can give you is about erasing a hard disk, the information can be accounted for by knowing the movement of the hard disk platters, the electrical impulses used to overwrite the data on the disk,; knowing those variables you could actually recreate the information stored on the disk.

 

[Papias]

Hey, thanks for the responses!


1. are you simply arguing for Dembski's idea?


rcorlew wrote:

It was not I who made that post/claim, I have no clue who this guy/gal is so I cannot comment on their claim(s).

Maybe resolved then- OK, so you haven't read dembski, and claim not to have heard of him.

Added later --->>> I just went back and found that you are the one who brought up Dembski in post #46

and
from rcorlew, post #44:

Even either one of the four corollaries to that law are far from trivial.

Of course I did. I mentioned him when you said that the "four corollaries" of the "conservation of information" were important. Dembski is the only source I know of that has "four corollaries" to the "conservation of information". Hence, I asked if Dembski was what you were basing this argument on. So, since you claim not to be getting this from Dembski, I have to ask where you are getting it - specifically, where you are getting it that has "four corollaries". If you can't show your source, which has four corollaries, it will appear that you did get it from dembski, and that would lead one to wonder about your response to question #1, above.


2. Did your "weeks of study" involve reading Dembski, or do you have real source for this that is relevant to biology?

rcorlew claims not to have read Dembski, but still won't give a real source that is relevant to biology.


3. Also, we are still waiting for your response to Shernren's example of erasing a hard disk - was the information conserved?

rcorlew wrote:

The only answer that I can give you is about erasing a hard disk, the information can be accounted for by knowing the movement of the hard disk platters, the electrical impulses used to overwrite the data on the disk,; knowing those variables you could actually recreate the information stored on the disk.

You really seem to think that information (as commonly understood) cannot be destroyed. For now, I'll wait to respond so as to give Shernren a chance to address this example that he brought up first.

4. Rcorlew, for how many years have you been doing thermodynamics calculations involving entropy?


*******************************************************

So, again here we are, you have absolutely no idea what the conservation of information is (physics), who has said what, and are acting a bit YECish at this point. So it would do you well to take some of the TE advice and go study what it is that you are talking about before posting any further.

I read the quantum physics one, and it is relevant in quantum systems, not in the macroscopic world we live in.

I read the ones metherion posted, and they not only aren't relevant, but they work in the opposite way you propose.

I read your explanations, and they seem to think that matter is information, and then only argue for the conservation of matter.

I think I understand this better than you, and I'm quite familiar with both thermodynamics and physics. Being that I see your misunderstanding, further reading of your misunderstanding and of the two kinds of irrelevant conservation of information doesn't seem like a useful way to spend time.

Is there some other source you see as relevant? Would you like to describe a situation in biology where there really is a conservation of information?

Papias

 

[rcorlew]

Hey, thanks for the responses!


1. are you simply arguing for Dembski's idea?


rcorlew wrote:


Maybe resolved then- OK, so you haven't read dembski, and claim not to have heard of him.



and
from rcorlew, post #44:

r035198x

Junior Member

26

Join Date: 15th July 2006
Posts: 228
Blessings: 8,264 [Bless]
Reps: 115,730,588,608,867,792 (power: 115,730,588,608,872)

Originally Posted by Papias

...
Is there a reason to think that the phrase "conservation of information" is anything other than something intended to sound sciency, but which in reality has no real content?

Papias
​

It is better for people who have not studied something to refrain from commenting on those things. A simple google search on "conservation of information" will give you an introduction. Even either one of the four corollaries to that law are far from trivial.

That was post #44, and it was not I who posted that as you can see in the header.
Of course I did. I mentioned him when you said that the "four corollaries" of the "conservation of information" were important. Dembski is the only source I know of that has "four corollaries" to the "conservation of information". Hence, I asked if Dembski was what you were basing this argument on. So, since you claim not to be getting this from Dembski, I have to ask where you are getting it - specifically, where you are getting it that has "four corollaries". If you can't show your source, which has four corollaries, it will appear that you did get it from dembski, and that would lead one to wonder about your response to question #1, above.


2. Did your "weeks of study" involve reading Dembski, or do you have real source for this that is relevant to biology?

rcorlew claims not to have read Dembski, but still won't give a real source that is relevant to biology.


3. Also, we are still waiting for your response to Shernren's example of erasing a hard disk - was the information conserved?

rcorlew wrote:



You really seem to think that information (as commonly understood) cannot be destroyed. For now, I'll wait to respond so as to give Shernren a chance to address this example that he brought up first.

4. Rcorlew, for how many years have you been doing thermodynamics calculations involving entropy?


*******************************************************



I read the quantum physics one, and it is relevant in quantum systems, not in the macroscopic world we live in.

I read the ones metherion posted, and they not only aren't relevant, but they work in the opposite way you propose.

I read your explanations, and they seem to think that matter is information, and then only argue for the conservation of matter.

I think I understand this better than you, and I'm quite familiar with both thermodynamics and physics. Being that I see your misunderstanding, further reading of your misunderstanding and of the two kinds of irrelevant conservation of information doesn't seem like a useful way to spend time.

Is there some other source you see as relevant? Would you like to describe a situation in biology where there really is a conservation of information?

Papias[/quote]

Maybe I can try to explain it differently, I am really trying to work with you, seriously.

The black hole information paradox results from the combination of quantum mechanics and general relativity. It suggests that physical information could "disappear" in a black hole, allowing many physical states to evolve into precisely the same state. This is a contentious subject since it violates a commonly assumed tenet of science—that in principle complete information about a physical system at one point in time should determine its state at any other time

Black hole information paradox - Wikipedia, the free encyclopedia

That is a brief read and well worth a few minutes of investigation

I just read some of Demski's work and it is wrought with problems which is probably why we did not study him. (I do not know why it keeps underlining my typing, I will try to fix that later, but it is not intentional)

OK, here is the pertinent principle "that in principle complete information about a physical system at one point in time should determine its state at any other time."

Small scale here, let us say, hypothetically if you will, you take an average dog and put him into a cage with a Tyrannosaurus Rex, 2 hours later you return to find only the T Rex, what happened to the dog? Well, he became dinner for our T Rex, but what about all stuff that made up the dog, you know, all the organic and inorganic compounds; well my friend they become part of the T Rex right (laughing because my dog is chasing his tail, hopefully the T Rex will start doing that). Information at this point is described as the physical attributes of matter/energy which is probably the best short description of information in regards to information theory. So the dog in the experiment could still be described by the chemical reactions producing energy for the T Rex for whatever it is that T Rexes do (maily cellular division through mitosis and meiosis I would presume).

Bigger scale here, and this will be possibly the best explanation possible although I will use some sloppy references somewhat on purpose so as not to detract from the idea, again the lineage will purposefully be errant for ease of reading.

In evolutionary lineage you can clearly see that a mouse evolved to become a dog in 200 generations through studying the fossil record. You have soft tissue samples of the original mouse and the common modern dog, you compare the genetic information in the DNA samples of both and you see that still present in the dog's DNA 200 specific sequences found only in the mouse and no where else so you have given sufficient cause to believe the theory the dog being a descendant of the mouse to be correct. This idea of the continuation of information (genome) is paramount to the Theory of Evolution, the thought that we are where we are today because of events that occurred yesterday, and far more previous than that, thus the information found in the mouse is conserved in within the information in the, yes there is entropy which is reversible given the known variables, but that is the basis of evolution right. The dog did not just appear, there was a flow of information to go from dirt to dog.

If you have further questions I will be glad to try and answer them, but do not be condescending by assuming that I do not know what I am talking about. For the record, four weeks is half of a full course, they are intensives, full year's study in 8 weeks which usually involves 100 - 200 pages of reading, 3-4 hours of lecture and 2 or 3 tests every week along with labs.

 

[mark kennedy]

That was post #44, and it was not I who posted that as you can see in the header.
Of course I did. I mentioned him when you said that the "four corollaries" of the "conservation of information" were important. Dembski is the only source I know of that has "four corollaries" to the "conservation of information". Hence, I asked if Dembski was what you were basing this argument on. So, since you claim not to be getting this from Dembski, I have to ask where you are getting it - specifically, where you are getting it that has "four corollaries". If you can't show your source, which has four corollaries, it will appear that you did get it from dembski, and that would lead one to wonder about your response to question #1, above.

Just to be sure, are these the 4 corollaries you speak of:

1) The CSI (Complex Specified Information) is a closed system of natural causes remains constant or decreases.
2) CSI cannot be generated spontaneously, originate endogenously organize itself (as these terms are used in origins of life research).
3)The CSI in a closed system of natural causeseither has been in the system eternally or it was at some point added exogenously. (implying that the system, though now closed, was not always closed).
4) In particular any closed system of natural causes that is also of finitie duration vecane a received whatever CSI it contains before it became a closed system. (William Dembinski, Intelligent Design) ​

Just want to be clear since I arrived a little late.

I just read some of Demski's work and it is wrought with problems which is probably why we did not study him.

The evolutionists on this board should definitely read Dembski, they would learn something about naturalism. They act like they have no idea what I'm talking about when I mention Darwinism or Naturalism, you can't have a conversation like this unless you know the requisite epistemology and how it contradicts Christian theism.

 

[Papias]

First the Mea Culpa:

Yep, that's correct - you didn't write post #44. I'm sorry that I misread that you had. We agree then on Dembski and the whole Dembski thing is irrelevant.

Rcorlew wrote:

Maybe I can try to explain it differently, I am really trying to work with you, seriously.

OK. I'll be nicer.

I did read the black hole thing, but again, this is not relevant in our world, which is very much an open system. Yes, in princible one can trace back earlier states, but let me give an example and explain something about that.

OK, here is the pertinent principle "that in principle complete information about a physical system at one point in time should determine its state at any other time."

Small scale here, let us say, hypothetically if you will, you take an average dog and put him into a cage with a Tyrannosaurus Rex, 2 hours later you return to find only the T Rex, what happened to the dog? Well, he became dinner for our T Rex, but

Imagine that I had the bill of rights written on a slab of tin, which I then melted, letting the molten pool of tin sit for a while. The atoms very quickly attain a constant exchange of energy, giving a gaussian energy distribution. The differences in the amount of energy that resulted from their inititial placement in a letter or such quickly becomes irrelevant, lost to other atomic collisions and such. Those differences also become very small, well below quantum limits. Thus QM will prevent the "trace back" principle from even being theoretically possible. However, even without the quantum stuff (which is rarely relevant in the real world), the amounts are not practically traceable, and so for all real world considerations, the information is permanently lost.

This same situation applies for chemical reactions and the mixing of liquids, as in your T Rex/dog example.


rcorlew wrote:

Bigger scale here, and this will be possibly the best explanation possible although I will use some sloppy references somewhat on purpose so as not to detract from the idea, again the lineage will purposefully be errant for ease of reading.

In evolutionary lineage you can clearly see that a mouse evolved to become a dog in 200 generations through studying the fossil record. You have soft tissue samples of the original mouse and the common modern dog, you compare the genetic information in the DNA samples of both and you see that still present in the dog's DNA 200 specific sequences found only in the mouse and no where else so you have given sufficient cause to believe the theory the dog being a descendant of the mouse to be correct. This idea of the continuation of information (genome) is paramount to the Theory of Evolution, the thought that we are where we are today because of events that occurred yesterday, and far more previous than that, thus the information found in the mouse is conserved in within the information in the, yes there is entropy which is reversible given the known variables, but that is the basis of evolution right. The dog did not just appear, there was a flow of information to go from dirt to dog.

Yes, some information from earlier lineages is preserved (and this is useful), but there are plenty of changes in the genome, which show that information is not conserved. For instance, looking at mutations, here are some basic types of mutations and how they work:

1. Duplication of a stretch of DNA. This is like accidentally copying part of a book twice. Example – when making a copy of a book that has chapters 1, 2, 3,4,5,6,7,8,9,10,11, 12, you end up with a book that has chapters 1, 2, 7,8,9, 3,4,5,6,7,8,9,10,11, 12
2. Deletion of a base pair. AATCTGTC becomes ATCTGTC
3. Addition of base pair AATCTGTC becomes ACATCTGTC
4. Transposition (like a mirror) AATCTGTC becomes CTGTCTAA

All of these can have no effect, an effect which is selected for, or an affect which is selected against.

To add information, first, take a functional gene, and make an extra copy using the duplication mutation. That won’t hurt the organism, since the second copy is simply redundant. Then use any of the other mutation methods so as to make the second copy do something new. The organism still has the original copy doing whatever it is supposed to do, but now has the added ability of whatever the new gene does (such as digesting nylon, as in a species of bacteria).

The process can also add entire chromosomes, and it shows that information is routinely added which was not there previously. There wasn't even a section of DNA you can point to that was changed to make the new information, because it was made from a copy of another gene which is still present.

Similarly, information is routinely destroyed. Some mutations and snip out and throw away whole sections of DNA, and after all, any mutation is a change in the DNA sequence, so at least some of the previous DNA information is lost.

As humans, we've lost the information to code for hundreds of scent molecules, for instance.

So in going through a long lineage, say from bacteria to humans, there is a huge amount of information added throughout the process - genes for new abilities, and so on. You can see this just by looking at size - out geneome is much larger than that of most bacteria.

All of these show that information is not, on a practical level, conserved in biology.

Are those starting to make sense?

Thanks-

Papias

 

[rcorlew]

First the Mea Culpa:

Yep, that's correct - you didn't write post #44. I'm sorry that I misread that you had. We agree then on Dembski and the whole Dembski thing is irrelevant.

Rcorlew wrote:


OK. I'll be nicer.

I did read the black hole thing, but again, this is not relevant in our world, which is very much an open system. Yes, in princible one can trace back earlier states, but let me give an example and explain something about that.





Imagine that I had the bill of rights written on a slab of tin, which I then melted, letting the molten pool of tin sit for a while. The atoms very quickly attain a constant exchange of energy, giving a gaussian energy distribution. The differences in the amount of energy that resulted from their inititial placement in a letter or such quickly becomes irrelevant, lost to other atomic collisions and such. Those differences also become very small, well below quantum limits. Thus QM will prevent the "trace back" principle from even being theoretically possible. However, even without the quantum stuff (which is rarely relevant in the real world), the amounts are not practically traceable, and so for all real world considerations, the information is permanently lost.

This same situation applies for chemical reactions and the mixing of liquids, as in your T Rex/dog example.


rcorlew wrote:


Yes, some information from earlier lineages is preserved (and this is useful), but there are plenty of changes in the genome, which show that information is not conserved. For instance, looking at mutations, here are some basic types of mutations and how they work:

1. Duplication of a stretch of DNA. This is like accidentally copying part of a book twice. Example – when making a copy of a book that has chapters 1, 2, 3,4,5,6,7,8,9,10,11, 12, you end up with a book that has chapters 1, 2, 7,8,9, 3,4,5,6,7,8,9,10,11, 12
2. Deletion of a base pair. AATCTGTC becomes ATCTGTC
3. Addition of base pair AATCTGTC becomes ACATCTGTC
4. Transposition (like a mirror) AATCTGTC becomes CTGTCTAA

All of these can have no effect, an effect which is selected for, or an affect which is selected against.

To add information, first, take a functional gene, and make an extra copy using the duplication mutation. That won’t hurt the organism, since the second copy is simply redundant. Then use any of the other mutation methods so as to make the second copy do something new. The organism still has the original copy doing whatever it is supposed to do, but now has the added ability of whatever the new gene does (such as digesting nylon, as in a species of bacteria).

The process can also add entire chromosomes, and it shows that information is routinely added which was not there previously. There wasn't even a section of DNA you can point to that was changed to make the new information, because it was made from a copy of another gene which is still present.

Similarly, information is routinely destroyed. Some mutations and snip out and throw away whole sections of DNA, and after all, any mutation is a change in the DNA sequence, so at least some of the previous DNA information is lost.

As humans, we've lost the information to code for hundreds of scent molecules, for instance.

So in going through a long lineage, say from bacteria to humans, there is a huge amount of information added throughout the process - genes for new abilities, and so on. You can see this just by looking at size - out geneome is much larger than that of most bacteria.

All of these show that information is not, on a practical level, conserved in biology.

Are those starting to make sense?

Thanks-

Papias

No, I am completely with you. The basis I believe that you work on is that entropy must be able to be calculated, energy does not just disappear. Now in your explanation of the genome, you state that there are mutations that destroy information which is not entirely true, what does occur is information is translated from its useful current state into another state which can be useless or even harmful, but that "new" information can be explained, and will always consist of the same building blocks of the genome (DNA or RNA respectively)

Smoking is an entropic process, by which cells containing genetic information within the lungs have their alleles altered which are responsible for growth and become cancerous. The mutation in the genetic information is directly related to the chemical information found in the smoke, now here is the principle of conservation (which I completely agree is highly impractical and usually impossible currently) the information "loss" in the genetics of the lung is directly representable by the information it took to cause the mutation, thus the information useful in the genetics of the lung tissue becomes useless information about the process of gene mutation.

That is the relation to the biology principle, knowing an organism's current state, all prevailing forces preceding its current state (variables over time) you can predict its previous sates at any point. This is the apparent "randomness" we find in nature, although it may be currently impossible to calculate all of the factors, in theory, it is possible.

 

[Papias]

rcorlew wrote:

That is the relation to the biology principle, knowing an organism's current state, all prevailing forces preceding its current state (variables over time) you can predict its previous sates at any point. This is the apparent "randomness" we find in nature, although it may be currently impossible to calculate of the factors, in theory, it is possible.

Yes, I think we agree. Under the principle of "back tracking", one could conserve information, but we agree that that is not relevant in biology.

you state that there are mutations that destroy information which is not entirely true, what does occur is information is translated from its useful current state into another state which can be useless or even harmful, but that "new" information can be explained, and will always consist of the same building blocks of the genome (DNA or RNA respectively)

Let me give an example. Consider the following section of DNA, which could be part of a gene or not:

GGATACCCCTATAGGTAGCTTAGTAACCGGATTGGATGATGTGTCTGCCTATCGTAG


OK, now consider a deletion mutation causes this bolded section not to be copied:

GGATACCCCTATAGGTAGCTTAGTAACCGGATTGGATGATGTGTCTGCCTATCGTAG


Resulting in this being the section that ends up in the offspring instead of the section I started with:

GGATACCCCTATAGCCTATCGTAG

Information was lost. It's not just "rendered useless", it's just plain gone.

No, I am completely with you.

Yeah, I think we are on the same page. have a good day-

Papias

 

[shernren]

I give up on the hard disk example.

I'm still very curious as to how one would measure the information in, say, an atom.

How much information is there in an atom?

How much information is there in a dog?

How can you ensure that the amount of information in an atom, multiplied by the number of atoms in a dog, equals the amount of information in a dog?

 

[Assyrian]

How much information is there in an atom?

How much information is there in a dog?

How can you ensure that the amount of information in an atom, multiplied by the number of atoms in a dog, equals the amount of information in a dog?

Cheers!

 

[Chesterton]

The molecule K9

 

[pgp_protector]

Cheers!

I think I'll use some of that tonight

 

[rcorlew]

I give up on the hard disk example.

I'm still very curious as to how one would measure the information in, say, an atom.

How much information is there in an atom?

How much information is there in a dog?

How can you ensure that the amount of information in an atom, multiplied by the number of atoms in a dog, equals the amount of information in a dog?

Trying to define information is like nailing jello to a wall, but I will give it a good stab just for grins.

Information can be summed up (I hope) as all of the answerable questions about any item or object. The question could be about anything, atomic make up, direction of travel, organic molecules. I would suppose that there would even be information in nothing because you can measure how much nothing there is, like how much hyper space actually exists, hyper space is nothing, no matter or energy, yet hyper space can be measured and when this nothing becomes something the process of negative entropy can be calculated.

The only part that really pertains to biology is this, take a common house cat and it would be able to reproduce for a million consecutive generations unless something acts on the cat to cause a change, the change in the cat's offspring could then be explained by the cause of the change. In other words, things do not just change, something causes them to change and this explains the change in information, in theoretical terms, the change in the cat's information is translated into the information about the change (in this case the cat ate a radioactive grasshopper and now the cat's offspring have two stomachs lol).