Genetic evidence and evolution

[AnEmpiricalAgnostic]

Pseudogenes:

Pseudogenes are formerly functional genes that have been crippled by mutation. Usually these crippled genes will be selected against and filtered out of a population. Occasionally these pseudogenes are not selected against and will fix themselves in a population. Once fixed in a population descendants of that population will all have a copy of the pseudogene. If more than one species share an identical pseudogene then those species must have shared a common ancestor in order to inherit that pseudogene.

Humans, like other primates, have a pseudogene that prevents them from producing ascorbic acid (Vitamin C). This is due to a mutated gene called L-gulono-gamma-lactone oxidase (GULO) that no longer produces a crucial enzyme necessary for producing that molecule. When we look to the other primates that can not produce ascorbic acid we find that they posses the identical pseudogene that humans do.

This line alone is smoking gun evidence for biological evolution and common ancestry. There is simply no other reasonable explanation for why humans and other primates would each possess identical copies of this pseudogene. It can not be explained away by common design since the genes are broken nor can it be dismissed as a coincidence.

ERVs (Endogenous retroviral infections):

Retroviral infections insert genetic fragments that can become fixed in a population and passed down to descendants much like pseudogenes.

When we map out the human ERVs and ERVs of other primates we find that we have retroviral insertions in identical locations. Again we have to ask ourselves what other rational explanation can there be for these genetic fragments to be shared between humans and other primates in such a way to suggest we inherited them from common ancestors.

Human chromosome two:

Human chromosome two is an exact copy of two ape chromosomes fused together. When we line up the chromosomes it becomes apparent from the banding.

Additionally, chromosomes end in telomeres and contain centromeres near the middle. When we look for these in human chromosome two we find telomeres in the middle and centromeres half way between the middle and both ends. This further evidences that human chromosome two is indeed the product of two fused ape chromosomes.

Conclusion:

In the end these lines of evidence not only support the Theory of Evolution but were predicted by it. There is no other reasonable explanation for these lines of evidence other than the validity of the TofE and common ancestry.

 

[mark kennedy]

Commentary Press essay​

Apparently my opponent has waived the opening post and decided to jump right into the evidence. That's fine, it will give me a chance to deal with his comments directly. Before I dig into this one I just wanted to thank EmpiricalAgnostic for taking up my challenge and I am looking forward to the exchange.

In the spirit of the C&E forums, may the truth prevail.

Pseudogenes:
Pseudogenes are formerly functional genes that have been crippled by mutation. Usually these crippled genes will be selected against and filtered out of a population. Occasionally these pseudogenes are not selected against and will fix themselves in a population. Once fixed in a population descendants of that population will all have a copy of the pseudogene. If more than one species share an identical pseudogene then those species must have shared a common ancestor in order to inherit that pseudogene.

This is not what we are looking at there, the gene has been crippled but that is because the function is not vital. Because of that the mutations in the gene were not affecting the populations mutations were not being screened so the gene became disfunctional. There is no reason to conclude that natural selection would expunge the gene, only that there was no negative selection acting on the mutated gene so the mutation became fixed.

Humans, like other primates, have a pseudogene that prevents them from producing ascorbic acid (Vitamin C). This is due to a mutated gene called L-gulono-gamma-lactone oxidase (GULO) that no longer produces a crucial enzyme necessary for producing that molecule. When we look to the other primates that can not produce ascorbic acid we find that they posses the identical pseudogene that humans do.

Some acute observations and a good general characterization of the gene. There are a couple of papers on the subject OMIM if anyone is interested in more of the details:

"The mechanism whereby an organism loses a particular metabolic function which is of no use in a particular environment was discussed by King and Jukes (1969). The accumulation of random mutations in the gene for the relevant enzyme might be expected to destroy the functional capacity of the enzyme, most mutations being disruptive. If the enzyme is not required in the particular environment, the constraint of selection is removed."

HYPOASCORBEMIA​

This line alone is smoking gun evidence for biological evolution and common ancestry. There is simply no other reasonable explanation for why humans and other primates would each possess identical copies of this pseudogene. It can not be explained away by common design since the genes are broken nor can it be dismissed as a coincidence.

The explanation is simply that the environment made the gene unnessacary so it became disfuntional. We have a psuedo gene that was working fine at some point whether we were specially designed or not. There were mutations that created an inborn error in metabolism whether we evolved from apes or not. To say that only common ancestry can explain this is begging the question of proof. The characterization of the gene does not make special creation and common ancestry mutually exclusive. We just both have this gene that is now disfunctional and that is the extent of it.

(Endogenous retroviral infections):
Retroviral infections insert genetic fragments that can become fixed in a population and passed down to descendants much like pseudogenes.

On the left of the chart below you will see the transposons, psuedo genes fall under this classification. Then on the right you will see the classification of retroelements which is where you find the ERVs. The retroelements make up about 47% of the human genome and the LTRs, including the ERVs comes to about 8%. The fact that they are a lot alike is not a problem, it's the differences that TOE is going to have to account for. I thought a chart might be helpfull to see how they are catagorized.

Classification of transposable elements

When we map out the human ERVs and ERVs of other primates we find that we have retroviral insertions in identical locations. Again we have to ask ourselves what other rational explanation can there be for these genetic fragments to be shared between humans and other primates in such a way to suggest we inherited them from common ancestors.

We can ask that question but there are alternatives to common ancestry that the talk origins chart does not include:

"Two larger gammaretrovirus-like groups (PtG1 and PtG2) occurred in chimpanzees but not in humans. The PtG sequences were most similar to two baboon ERVs and a macaque sequence but neither to other chimpanzee ERVs nor to any human gammaretrovirus-like ERVs.The pattern was consistent with cross-species transfer via predation. This appears to be an example of horizontal transfer of retroviruses with occasional fixation in the germ line.
"

Divergent Patterns of Recent Retroviral Integrations in the Human and Chimpanzee Genomes: Probable Transmissions between Other Primates and Chimpanzees​

They were certainly quick to explain this one away since they occured in chimpanzees but not in humans. There is no smoking gun here, just wild speculation about what might be the explanation. When you look at the Talk Origins tree in looks like it's cut and dried but you are only looking at one segment of LTRs that number in the thousands. Of course there will be some that have simular sequences in the same place. Its the differences and the contradictions of the cherished assumptions of evolutionists that is hard to explain:

"In a new study, Evan Eichler and colleagues scanned finished chimpanzee genome sequence for endogenous retroviral elements, and found one (called PTERV1) that does not occur in humans. Searching the genomes of a subset of apes and monkeys revealed that the retrovirus had integrated into the germline of African great apes and Old World monkeys—but did not infect humans and Asian apes (orangutan, siamang, and gibbon). This undermines the notion that an ancient infection invaded an ancestral primate lineage, since great apes (including humans) share a common ancestor with Old World monkeys."

(2005) The Chimp Genome Reveals a Retroviral Invasion in Primate Evolution. PLoS Biol 3(4): e126 (available online)​

Let's not forget we are talking about a very large part of the genome here. Are we going to conclude that we owe over 8% of the nucleotide sequences of the respective genomes to viruses? Viruses have genetic codes that are counted in the thousands of base pairs.

It's the old trick of evolution again, if it's simular then it supports a homology arguement and if it's different then the explanation must be natural selection. I am far from convinced that everyone of the LTRs is the result of viruses. What is more the first proposal of ERVs being used as phylogentic markers was in 1999, it is like the other theories in TOE. It will run it's course for decades and in the end it will have it's false assumptions exposed only to be replace by something equally presumptive.

The thing you have to realize is that a common ancestor would have had a distinct DNA sequence. It's not the things that are the sequences that are the same that are crucial to TOE. They are left with the burden of proof for explaining how the differences got there given the mutation rate and the known differences in the respective genomes.

Human chromosome two:
Human chromosome two is an exact copy of two ape chromosomes fused together. When we line up the chromosomes it becomes apparent from the banding.


Additionally, chromosomes end in telomeres and contain centromeres near the middle. When we look for these in human chromosome two we find telomeres in the middle and centromeres half way between the middle and both ends. This further evidences that human chromosome two is indeed the product of two fused ape chromosomes.

Now for the chromosomal rearrangements, this one has a tag sequence right where it was expected to be if there was a chormosomal fusion. That's great! There is just one major problem with this, there was actually 9 major chromosomal rearrangements that total 20 million base pairs, one of which is 4 million base pairs long. If this were the only chromosomal rearrangement then I would say it explains things as well as can be expected. What about the other 8 major chromosomal rearrangements and the multitude of indels and polymorphisms littered throughout the respective genomes?

I am not going to ask my opponent to explain every single difference between the two genomes. What I am going to do is ask him to look at them. This is an imporant illustration of the structural differences. Again, am not asking for an explanation of every single one, I just want you to consider them.


Summary of structural variation between chimpanzee and human.(click on image to enlarge)

This one shows a larger inversion on chromosome 12, I just want you to look at it for a minute and we can move on.

(B) A large (44-Mb) inversion on human chromosome 12 identified by our analysis.

A genome-wide survey of structural variation between human and chimpanzee A genome-wide survey of structural variation between human and chimpanzee

I can tell you right now where I intend to take this, to the actual differences. The ERVs while enigmatic are not some smoking gun and they are far from consistant with the a priori assumption that they are all the result of viral germline invasions. The genetic basis of evolution with regards to human evolution will pass or fail on whether or not there is a way to account for the accelerated evolution of human beings from apes. The psuedo genes do not cause any real problems and the ERVs don't make any sense unless you want to let germline invasions explain 8% of our genome. It wouldn't be so bad if germline invasions were common but the last time I checked the age of these LTRs are from 200,000 to 30 million years ago.

Conclusion:

In the end these lines of evidence not only support the Theory of Evolution but were predicted by it. There is no other reasonable explanation for these lines of evidence other than the validity of the TofE and common ancestry.

A single psuedo gene and a couple of ERVs are not conclusive proof of evolution. They are at best fragmentary anecdotal evidence. Is there some way to explain how some of the LTRs are the result of viruses and the rest have some other explanation? If not then you will have a hard time explaining how viruses that have thousands of nucleotides for the gene flow could accumulate to be 8% of our genome.

Evolution is about the change of alleles in populations over time. The only way that human being evolved from apes is hundreds if not thousands of mutations in hundreds if not thousands of genes. Creation scientists who are following the development of Chimpanzee and human genomics are predicting that the actual differences in DNA between humans and chimpanzees is actually 90% based on the latest scientific research:

"Considering all the elements that determine sequence homology, when an entire sequence comparison is finally made between the human and chimpanzee genomes, the actual amount of DNA sequence homology is almost certainly going to be less than 90%."

Genomics at ICR, by Daniel Criswell, Ph.D.​

Nature magazine claims it's 98%, someone has to be wrong. Based on the actual scientific evidence how much of the DNA in the two genomes of chimpanzees and humans are the same?

What makes us human? We share more than 98% of our DNA and almost all of our genes with our closest living relative, the chimpanzee. Comparing the genetic code of humans and chimps will allow the study of not only our similarities, but also the minute differences that set us apart.

The chimpanzee genome
​

This is the most common result of a mutation:​

They can't both be right, who would you say is making the accurate statement?

This is what they are telling us was the result of mutational forces that shaped our species:​

[b/]

Speculation about ERVs and psuedo genes does not even begin to explain the evolution of human beings from apes. The assumption that ERVs are the result of germline invasions of the germline is staggering in it's implications. We can attribute 8% of our DNA to viruses? Sooner or later we have to have a genetic basis for the changes that led up to the emergance of Homo sapien sapiens.

Conclusion

The homology arguement about psuedo genes and ERVs does not offer a shred of evidence for evolution. It demonstrates a couple of identical alleles but no mechanism for changing protein coding or regulatory genes involved in the adaptation of the human brain or other vital functions. If two entire genomes completely sequenced doesn't define the burden of proof for evolution I don't know what will. Look at the differences, consider the common ancestor and then tell me how did we get all those changes into 7 million years?

 

[AnEmpiricalAgnostic]

Apparently my opponent has waived the opening post and decided to jump right into the evidence. That's fine, it will give me a chance to deal with his comments directly. Before I dig into this one I just wanted to thank EmpiricalAgnostic for taking up my challenge and I am looking forward to the exchange.

Sorry about that. As I said before we started, I don’t have any formal debate experience. I suppose I should have looked a few up to use as a template.

This is not what we are looking at there, the gene has been crippled but that is because the function is not vital. Because of that the mutations in the gene were not affecting the populations mutations were not being screened so the gene became disfunctional. There is no reason to conclude that natural selection would expunge the gene, only that there was no negative selection acting on the mutated gene so the mutation became fixed.

I’m sorry if I made it sound like I was asserting something different. I agree with everything you have said here. What is important is what happens after the pseudogene becomes fixed in a population of organisms. Because descendants of that population will be born with a copy of it, the pseudogene becomes a sort of flag which we can use to track all the descendants of that population. The reason I focus on pseudogenes is because it takes away the argument of common design. Designing organisms with dysfunctional genes doesn’t make sense.

The explanation is simply that the environment made the gene unnessacary so it became disfuntional. We have a psuedo gene that was working fine at some point whether we were specially designed or not. There were mutations that created an inborn error in metabolism whether we evolved from apes or not. To say that only common ancestry can explain this is begging the question of proof. The characterization of the gene does not make special creation and common ancestry mutually exclusive. We just both have this gene that is now disfunctional and that is the extent of it.

You are leaving out the one crucial detail which brings us back to the meat of the argument... because this GULO Pseudogene we have is the same as that found in other primates the only reasonable explanation is that we both inherited it from a common ancestral population. Loudmouth was also so kind as to point out to me that comparisons of the GULO Pseudogene between primate series fall into a nested hierarchy.

Comparisons of the pseudogene between primate series fall into a nested hierarchy. This makes zero sense in a common designer paradigm.
Copying from the talkorigins page:

http://www.talkorigins.org/faqs/comdesc/section2.html

Recently, the L-gulano-γ-lactone oxidase gene, the gene required for Vitamin C synthesis, was found in humans and guinea pigs (Nishikimi et al. 1992; Nishikimi et al. 1994). It exists as a pseudogene, present but incapable of functioning (see prediction 4.4 for more about pseudogenes). In fact, since this was originally written the vitamin C pseudogene has been found in other primates, exactly as predicted by evolutionary theory. We now have the DNA sequences for this broken gene in chimpanzees, orangutans, and macaques (Ohta and Nishikimi 1999). And, as predicted, the malfunctioning human and chimpanzee pseudogenes are the most similar, followed by the human and orangutan genes, followed by the human and macaque genes, precisely as predicted by evolutionary theory. Furthermore, all of these genes have accumulated mutations at the exact rate predicted (the background rate of mutation for neutral DNA regions like pseudogenes) (Ohta and Nishikimi 1999).

Personally, the reappearance of a nested hierarchy at every turn when looking at genetics is perhaps the best unifying piece of evidence there is. It is also echoed in the ERV comparisons.

I honestly don’t see any other reasonable explanation for this other than common ancestry. If common ancestry is correct then humans and other primates evolved from the same population of organisms. The evidence supports this. Do you have any other explanation?

On the left of the chart below you will see the transposons, psuedo genes fall under this classification. Then on the right you will see the classification of retroelements which is where you find the ERVs. The retroelements make up about 47% of the human genome and the LTRs, including the ERVs comes to about 8%. The fact that they are a lot alike is not a problem, it's the differences that TOE is going to have to account for. I thought a chart might be helpfull to see how they are catagorized.

Thank you for the information but I beg to differ on your assertion that “The fact that they are a lot alike is not a problem, it's the differences that TOE is going to have to account for”. The TofE doesn’t prohibit differences. In fact, there must be differences by necessity. If separate populations didn’t incur unique mutations then they would never speciate. This all fits within the framework of the TofE does it not?

Additionally, as Loudmouth pointed out, the ERVs fall into a nested hierarchy just as the TofE predicts (like the GULOP).

The differences fall into a nested hierarchy. That is, the human-old world monkey differences are greater than the human-gorilla differences which are again greater than the human-chimp differences. A nested hierarchy is a prediction of the ToE, and a nested hierarchy is found.

It seems that close inspection of the differences only uncovers further support for the TofE. What other reason would this nested hierarchy keep coming up in various lines of evidence?

While I understand why this issue is a personal problem given your beliefs, unless you can show that the differences are impossible within the framework of the TofE, it is an argument from personal incredulity and not evidence refuting the TofE.

We can ask that question but there are alternatives to common ancestry that the talk origins chart does not include:
"Two larger gammaretrovirus-like groups (PtG1 and PtG2) occurred in chimpanzees but not in humans. The PtG sequences were most similar to two baboon ERVs and a macaque sequence but neither to other chimpanzee ERVs nor to any human gammaretrovirus-like ERVs.The pattern was consistent with cross-species transfer via predation. This appears to be an example of horizontal transfer of retroviruses with occasional fixation in the germ line."

Again, with some help from Loudmouth I learned that there are two kinds of ERVs, homologous and orthologous.

He confuses the concept of homologous and orthologous ERV's. Homologous ERV's are insertions from the same virus. However, these insertions do not occur at the same spot in the genomes. This means that these ERV's are due to separate infections in the two lineages. Orthologous ERV's, on the other hand, are from the same virus AND the same insertion because they are found at the same spot in the host genomes.

The ERVs you speak of here are homologous retroviruses. The orthologous ERVs are the ones used for evidencing common ancestry since they are from the same virus AND in the same location. Homologous retroviruses are not relevant to this discussion because they are not useful showing common ancestry nor are they useful in refuting the TofE (unless you can show differently). In addition to this the paper that you take the quote from talks about recent retroviral insertions in primate genomes (recent meaning after the human chimp split).

"In a new study, Evan Eichler and colleagues scanned finished chimpanzee genome sequence for endogenous retroviral elements, and found one (called PTERV1) that does not occur in humans. Searching the genomes of a subset of apes and monkeys revealed that the retrovirus had integrated into the germline of African great apes and Old World monkeys—but did not infect humans and Asian apes (orangutan, siamang, and gibbon). This undermines the notion that an ancient infection invaded an ancestral primate lineage, since great apes (including humans) share a common ancestor with Old World monkeys."

In the very next paragraph I found this:

"Eichler and colleagues found over 100 copies of PTERV1 in each African ape (chimp and gorilla) and Old World monkey (baboon and macaque) species. The authors compared the sites of viral integration in each of these primates and found that few if any of these insertion sites were shared among the primates. It appears therefore that the sequences have not been conserved from a common ancestor, but are specific to each lineage." (Emphasis mine)

Again, you are not talking about orthologous retroviruses. The orthologous retroviruses at the same integration site are the ERVs that are meaningful and support common ancestry. Homologous retroviruses only serve to obfuscate the issue since they are not at the same insertion sites. Can you show me how homologous retroviruses refute the TofE? Do you have another explanation as to why retroviruses that are shared between humans and other primates at the same insertion sites form a nested hierarchy?

It's the old trick of evolution again, if it's simular then it supports a homology arguement and if it's different then the explanation must be natural selection.

Please don’t start appealing to emotion. The TofE is a legitimate scientific theory explaining biodiversity. It isn’t trying to trick anyone. When we examine the genome we find similarities and differences. When we examine these similarities we find that the closer the phylogenic relationship the more similarities there are genetically. When we look at the differences we repeatedly see nested hierarchies emerge. The TofE is simply the best explanation for this. Do you have another?

I am far from convinced that everyone of the LTRs is the result of viruses. What is more the first proposal of ERVs being used as phylogentic markers was in 1999, it is like the other theories in TOE. It will run it's course for decades and in the end it will have it's false assumptions exposed only to be replace by something equally presumptive.

No offense but the validity TofE doesn’t hinge on convincing you (or anyone) of anything personally. What is important is the evidence. As new evidence is discovered the theory will continue to be refined. This is the hallmark and strength of all scientific theories. Thus far the evidence presented here supports the TofE while nothing presented refutes it. You may not like the theory personally but unless you can come up with compelling evidence refuting it, it will remain the best explanation for the diversity of life we have and I will continue to provisionally accept it as true.

The thing you have to realize is that a common ancestor would have had a distinct DNA sequence. It's not the things that are the sequences that are the same that are crucial to TOE. They are left with the burden of proof for explaining how the differences got there given the mutation rate and the known differences in the respective genomes.
I am not going to ask my opponent to explain every single difference between the two genomes. What I am going to do is ask him to look at them. This is an imporant illustration of the structural differences. Again, am not asking for an explanation of every single one, I just want you to consider them.

If you have solid scientific evidence that the differences we find from species to species is impossible within the framework of the TofE then you will have a valid argument. What you are doing here is a sort of gaps argument pointing at unknowns and calling for a complete dismissal of the theory you don’t like in favor of a philosophical assertion you do. Your personal dislike is causing you to argue from personal incredulity instead of providing scientific evidence that refutes it. I know it must be frustrating but you can’t expect a well substantiated scientific theory to simply be thrown away because a few details aren’t fully explained no matter how much you don’t like it.

Now for the chromosomal rearrangements, this one has a tag sequence right where it was expected to be if there was a chormosomal fusion. That's great! There is just one major problem with this, there was actually 9 major chromosomal rearrangements that total 20 million base pairs, one of which is 4 million base pairs long. If this were the only chromosomal rearrangement then I would say it explains things as well as can be expected. What about the other 8 major chromosomal rearrangements and the multitude of indels and polymorphisms littered throughout the respective genomes?

Again, you are ignoring the evidence presented and going after unknowns to make your case. How does this change the fact that we apparently have a gene that is created from the fusion of two primate genes? This fact means that human chromosome two was made from two distinct chromosomes found in other primates. What other explanation can there be other than common ancestry? No matter how many other rearrangements you point out it doesn’t change the fact that chromosome two evidences common ancestry.


You have not addressed the evidence I have presented substantiating the TofE and common ancestry while confusing the issue by bringing up irrelevant homologous retroviruses without showing if, why, or how these pose a problem to the theory. The only argument that you have raised seems to be that there are too many differences that you personally feel comfortable with but as far as I can see there is nothing about those differences that refute the TofE. Please examine my arguments again and explain to me what possible explanation there can be for these things other than common ancestry.

 

[mark kennedy]

The reason I focus on pseudogenes is because it takes away the argument of common design. Designing organisms with dysfunctional genes doesn’t make sense.

The pseudogene does not take away from either an arguement of design or a common ancestor. It is simply a malfunctioned gene, you agreed with everything I said and then jump to a non sequitur conlcusion. You even agreed that the disfunction was the result of a mutation where natural selection did not act because it wan't a strong enough effect. We know what it was supposed to do and have every reason to expect that at one time it did it. With that your argument can be dismissed since you are using a logical fallacy.

If common ancestry is correct then humans and other primates evolved from the same population of organisms. The evidence supports this. Do you have any other explanation?

Of course it was inherited and they are inherited in seperate lineages with no need for a common ancestor to explain their disfunction. Here again you conlcusion does not follow the evidence but is in fact an assumption of common ancestry not an informed conclusion that logically follows the evidence.

Thank you for the information but I beg to differ on your assertion that “The fact that they are a lot alike is not a problem, it's the differences that TOE is going to have to account for”. The TofE doesn’t prohibit differences. In fact, there must be differences by necessity. If separate populations didn’t incur unique mutations then they would never speciate. This all fits within the framework of the TofE does it not?

First of all the differences are a major problem for TOE since they must be accumulated. Mutations are the only way DNA is altered and the differences between chimpanzees and humans in the DNA is not accounted for based on the observed mutation rate. If you think that the mutation rate accounts for the divergance between men and apes you are woefully misinformed.

Why don't you ask your friend Loudmouth what the mutation rate would have to be for 35 million base pairs over a 7 million year period with a generation being estimated at 20 years? You will probably get an estimate anywhere from 1.7 x 10^-8 to 2.7 x 10^-9 depending on population size estimates. If you estimate it at 2.5 x 10^-8 then it comes to 173 mutations per diploid generation. Then you can factor in 35 single nucleotide substitutions and 90 Mb of indels. That's 125 Mb in 7 million years which is 517 mutations per generation.

Additionally, as Loudmouth pointed out, the ERVs fall into a nested hierarchy just as the TofE predicts (like the GULOP). It seems that close inspection of the differences only uncovers further support for the TofE. What other reason would this nested hierarchy keep coming up in various lines of evidence?

Since your arguement is simply something about nested hierarchy then it's just another unsupported claim. All I can figure is this is some homology arguement that identical sequences at identical locations are proof of common ancestry. You would have to assume that every ERV is the result of a germline invasion, something that has never been questioned. It only makes sense that the revese is true, unless you are fond of double standards that hold simularities as a proof for common ancestry and that differences are not a proof against common ancestry. Take a look at ERV class 1:

(Initial sequence of the chimpanzee genome and comparison with the human genome


Note the differences in the Class 1 ERVs.

While I understand why this issue is a personal problem given your beliefs, unless you can show that the differences are impossible within the framework of the TofE, it is an argument from personal incredulity and not evidence refuting the TofE.

That is itself a classic example of an arguement from personal incredulity since you just said that you just, "claimed that a premise is true only because it has not been proven false, or that a premise is false only because it has not been proven true."

Common ancestry is refuted by the weight of the evidence against the evolution of human DNA from that of an ape. The mutation rate would have to be three times what it is and this is impossible. It is impossible not because of my belief system by because the affects of mutations on genes, particularly the ones involved in neural functions is exclusivly deleterious. I base this on explicit scientific evidence. We know about what the mutation rate is supposed to be and what it would have to be for humans to evolve from apes and it just does not happen.

Again, with some help from Loudmouth I learned that there are two kinds of ERVs, homologous and orthologous. The ERVs you speak of here are homologous retroviruses. The orthologous ERVs are the ones used for evidencing common ancestry since they are from the same virus AND in the same location.

You seem to be lacking in any support for this assertion. Tell me the class, location and sequence identity of these orthologous ervs. In short, identify the ERVs and lets do an actual comparison because I never argued that a lot of the DNA was not the same. What would have had to happen is that mutations would have had to change what is different in the two genomes. Now stop argueing in circles around semantics and lets get to the actual evidence.

Homologous retroviruses are not relevant to this discussion because they are not useful showing common ancestry nor are they useful in refuting the TofE (unless you can show differently). In addition to this the paper that you take the quote from talks about recent retroviral insertions in primate genomes (recent meaning after the human chimp split).

First of all, I don't accept the assumption that all of these ERVs are the result of germline invasions. Last time I checked germline invasions were rare. Now you want me to accept without qualification that close to half of the human genome is the result of them. Your whole arguement rests on that one single assumption and it has never been qualified.

In the very next paragraph I found this:
Again, you are not talking about orthologous retroviruses. The orthologous retroviruses at the same integration site are the ERVs that are meaningful and support common ancestry. Homologous retroviruses only serve to obfuscate the issue since they are not at the same insertion sites. Can you show me how homologous retroviruses refute the TofE? Do you have another explanation as to why retroviruses that are shared between humans and other primates at the same insertion sites form a nested hierarchy?

This is what I found on the homologous retroviruses, what is the location of the orthologous ones?

Human Endogenous Retroviral Elements as Indicators of Ectopic
Recombination Events in the Primate Genome

Check out Table 1 and tell me why exactly this is not a group of ERVs that are suitable for comparison. The time of insertion predates the common acestor and if you are going to be particular about the ones we compare then identify, characterize and locate them.

Please don’t start appealing to emotion. The TofE is a legitimate scientific theory explaining biodiversity. It isn’t trying to trick anyone. When we examine the genome we find similarities and differences. When we examine these similarities we find that the closer the phylogenic relationship the more similarities there are genetically. When we look at the differences we repeatedly see nested hierarchies emerge. The TofE is simply the best explanation for this. Do you have another?

First of all you are throwing TOE around like it actually means something to you. Define evolution, because I know what the word means and it defines the burden of proof for a primate common ancestor. Stop argueing in circles and apply some meaning to the words you are using.

No offense but the validity TofE doesn’t hinge on convincing you (or anyone) of anything personally. What is important is the evidence. As new evidence is discovered the theory will continue to be refined. This is the hallmark and strength of all scientific theories. Thus far the evidence presented here supports the TofE while nothing presented refutes it. You may not like the theory personally but unless you can come up with compelling evidence refuting it, it will remain the best explanation for the diversity of life we have and I will continue to provisionally accept it as true.

No offense taken because you haven't provided a lick of evidence. There was some general discussion of a psuedo gene and a picture form TO of an ERV tree. You have yet to examine any of the carefully research evidence I am presenting and instead you argue in circles around assumptions. The evidence is clearly telling us that we are much more different then chimpanzees and the discovered differences are growing constantly. When it was 99% it all dovetailed nicely with genetics but guess what? Things have changed and now the differences can't be explained and right now none of the research is even trying to. Sure single substitutions are accounted for but the indels are being ignored because TOE cannot begin to account for them.

I know one thing about science, you can't call something a fact unless you can demonstrate it. So far, all that you have demonstrated is an unwaivering confidence in the reliablity of Talk Origins and Loudmouth.

If you have solid scientific evidence that the differences we find from species to species is impossible within the framework of the TofE then you will have a valid argument.

Give me your mutation rate, translate it into nucleotides per diploid generation and then identify the differences. I have allready done it but I have to get you to stop argueing in circles and look at the actual evidence.

What you are doing here is a sort of gaps argument pointing at unknowns and calling for a complete dismissal of the theory you don’t like in favor of a philosophical assertion you do.

No, I am comparing the human brain to the ape brain which is comparative anatomy. I am also making inferances from comparitive genomics based on the observed mutation rate, which is genetics. What you are doing is attributing my stubborn refusal to accept your a priori assumption to something philosophical. This is absurd since the only thing remotely philisophical in this discussion is your systematic dancing around the evidence.

I also want to be very clear on another point, I am not even remotely interested in refuting TOE as defined scientifically. Creation science has to have a radical version of TOE minus the single common ancestor so you are preaching to the choir. Did I mention that the single common ancestor model has absolutly nothing to do with evolution as science.

I'm waiting on that definition before I nail this one down for good.

Your personal dislike is causing you to argue from personal incredulity instead of providing scientific evidence that refutes it. I know it must be frustrating but you can’t expect a well substantiated scientific theory to simply be thrown away because a few details aren’t fully explained no matter how much you don’t like it.

Again, you are ignoring the evidence presented and going after unknowns to make your case. How does this change the fact that we apparently have a gene that is created from the fusion of two primate genes? This fact means that human chromosome two was made from two distinct chromosomes found in other primates. What other explanation can there be other than common ancestry? No matter how many other rearrangements you point out it doesn’t change the fact that chromosome two evidences common ancestry.


You have not addressed the evidence I have presented substantiating the TofE and common ancestry while confusing the issue by bringing up irrelevant homologous retroviruses without showing if, why, or how these pose a problem to the theory. The only argument that you have raised seems to be that there are too many differences that you personally feel comfortable with but as far as I can see there is nothing about those differences that refute the TofE. Please examine my arguments again and explain to me what possible explanation there can be for these things other than common ancestry.

"What possible explanation could there be?" That is nothing but an arguement from incredulity you are making while accusing me of it. Where is all of this evidence you imagine has entered the debate because all I see is my carefully prepared research left untouched in my opening rebuttal.

 

[AnEmpiricalAgnostic]

The pseudogene does not take away from either an arguement of design or an common ancestry. It is simply a malfunctioned gene, you agreed with everything I said and then jump to a non sequitur conlcusion. You even agreed that the disfunction was the result of a mutation where natural selection did not act because it wan't a strong enough effect. We know what it was supposed to do and have every reason to expect that at one time it did it. With that your argument can be dismissed since you are using a logical fallacy.

I’m afraid you still don’t fully understand the implications of the GULO pseudogene I’m presenting as positive evidence of the TofE and common ancestry. Maybe it’s my fault. I’ll try to be as clear as possible. I made a crude graphic to help illustrate my point further.

On line one we have a rat, a guinea pig, and a great ape. Rats have a functional copy of the GULO gene. Guinea pigs have a broken version of it as well as great apes.

At this point there is nothing of real interest. The proponent of evolution will attribute the fact that they each have or had a working copy of the same GULO gene to common ancestry while the creationist will argue common design.

A look at the gene shows that the one in the guinea pig and ape are broken differently (as cleverly illustrated by the different molecules of DNA exploding in different places and the horrid look on Mr. DNA’s face). So fine, it’s broken, big deal. If this were the end of the argument you would be right in dismissing it as a simple homology argument. Hang with me though; the good stuff is in the next paragraph.

PAY CLOSE ATTENTION TO THIS PARAGRAPH! An inspection of the gene shows that modern primates have the gene broken in the same way. THIS IS IMPORTANT. This is where something should strike you as funny. Why would these different primates have the gene broken in the same way? If they all had working copies of the gene at the start, then developed pseudogenes separately they should be broken differently (like the guinea pig). This is not what we see though. They are the same. Unless you posit that each of these organisms was created with identically broken pseudogenes then the only other explanation could be common ancestry. They all inherited it from the same population of organisms with a broken GULO gene.

Once again a closer inspection of the pseudogene reveals a nested hierarchy. Human-old world monkey differences are greater than the human-gorilla differences which are again greater than the human-chimp difference. I illustrated this by the multi-colored arrow pointing at the primate pseudogenes. What kind of sense does this make from the standpoint of common design? The only way it makes any sense at all is through common ancestry.

I also found a power point presentation that illustrates my point nicely.

http://www.indiana.edu/~ensiweb/pp.pseud.4.ppt

The first thing to take notice of it how each pseudogene is broken. They each have a deletion in an identical location. They are all broken the same way. Why would we find something like this is common ancestry is false?

Now really look at the alignment between human, chimp, orang, and macaque pseudogenes. You’ll see Human-macacaque differences are greater than the human-orang differences which are again greater than the human-chimp difference. Here are the breakdowns of the GULO/P (Exon10) for each animal in my argument:

Guinea pig GULOP (Exon10): CAGCACCTTCCTGCCGTGCCTCATGGGTTGGATCAATTGCTTCTTCTTCTGGCTGCTGTTCAACTGCAAGAAGGAGAACTGTGACTTCAGCCACAAGATCTTCAGCTATGAGTGCCGCTTCAAGCAGCACGTCCAGGACTGGGCCATCCCCAGGTAG

Rat GULO (Exon10): GAGAAGACCAAGGAGGCCCTACTGGAGCTAAAGGCCATGCTGGAGGCCCACCCCAAAGTGGTAGCCCACTACCCCGTAGAGGTGCGCTTCACCCGAGGCGATGACATTCTGCTGAGCCCCTGCTTCCAGAGGGACAGCTGCTACATGAACATCATTATGTAC

Human GULOP (Exon10): AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCGTGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCTGGTGGGGGTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGTGGGACAGCCGCTACCTGAACATCAACCTGTAC
Chimpanzee GULOP (Exon10): AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCCGAGGTGGTGTCCCACTACCTGGTGGGGCTACGCTTCACCTGGAG*GATGACATCCTACTGAGCCCCTGCTTCCAGCGGGACAGCCGCTACCTGAACATCAACCTGTAC
Orangutan GULOP (Exon10): AAGAAGACCACGGAGGCCCTGCTGGAGCTGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTACCCGGTGGGGGTGCGCTTCACCCAGAG*GATGACGTCCTACTGAGCCCCTGCTTCCAGCAGGACAGCCGCTATCTGAACATCAACCTGTAC
Macaque GULOP (Exon10): AAGAAGACCACAGGGGCCCTGCTGGAGATGAAGGCCATGCTGGAGGCCCACCCTGAGGTGGTGTCCCACTAACCGGTGGGGGTGCGCTTCACCCAAGG*GATGACATCATACTGAGCCCCTGCTTCCAGCAGGACAGCTGCTACCTGGACATCAACCTGTAC

I hope this clarifies my pseudogene argument. Once again I ask you to either show me how this evidence is flawed or to provide me with a better explanation for the evidence.

Of course it was inherited and they are inherited in seperate lineages with no need for a common ancestor to explain their disfunction.

But they are all the same. You keep missing that point. If they were created as separate lineages then, like the guinea pig, the gene would be broken in a unique way. Since they are all broken the same way then you would have to cling to the absurd notion that they were created with the same broken genes from the start or accept common ancestry. If you don’t understand this by now please go back and reexamine the top of this post until it sinks in. I don’t know how to make my argument clearer at this point.

Here again you conlcusion does not follow the evidence but is in fact an assumption of common ancestry not an informed conclusion that logically follows the evidence.

Common ancestry is the only reasonable explanation for the evidence at hand. I challenge you to provide another.

First of all the differences are a major problem for TOE since they must be accumulated. Mutations are the only way DNA is altered and the differences between chimpanzees and humans in the DNA is not accounted for based on the observed mutation rate. If you think that the mutation rate accounts for the divergance between men and apes you are woefully misinformed.

Why don't you ask your friend Loudmouth what the mutation rate would have to be for 35 million over a 7 million year period with a generation being estimated at 20 years? You will probably get an estimate anywhere from 1.7 x 10^-8 to 2.7 x 10^-9 depending on population size estimates. If you estimate it at 2.5 x 10^-8 then it comes to 173 mutations per diploid generation. Then you can factor in 35 single nucleotide substitutions and 90 Mb of indels. That's 125 Mb in 7 million years which is 517 mutations per generation.
The mutation rate would have to be three times what it is and this is impossible. It is impossible not because of my belief system by because the affects of mutations on genes, particularly the ones involved in neural functions is exclusivly deleterious. I base this on explicit scientific evidence. We know about what the mutation rate is supposed to be and what it would have to be for humans to evolve from apes and it just does not happen.

I’ll use a quote from sfs on the matter since he’s the geneticist:

... there is absolutely nothing surprising to geneticists about the divergence between humans and chimpanzees. The single-base mutation rate in humans is estimated to be 2x10^-8/bp/gen, which gives 60 mutations per genome copy per generation. Multiply that by two because humans and chimpanzees each accumulate mutations at the same rate. So we expect ~120 mutations per generation, half in humans and half in chimps.

Now neutral mutations (ones that are neither good nor bad for the individual) fix in the population (that is, reach 100% frequency) at the same rate they occur. (Note that any given mutation only has a tiny probability of fixing, but every individual in the population has his own set of new mutations, so there are a ton of mutations around to fix.) So, based on the known mutation rate, geneticists would expect (and did expect) 120 mutations/generation x 300,000 generations (six million years) = 36 million fixed single base differences between humans and chimps. Divided by the 3 billion bases in the genome, that's a predicted difference of 1.2%. The observed difference is 1.3%. (The number comes from the chimpanzee genome paper.) Pretty stunning success for evolution, I'd say.
That's single-base substitutions. There was no good prediction for indels, because there was no good estimate for the mutation rate, just a rough idea that they occur about one-tenth as often as single base substitutions. Comparison of the human and chimp genomes (in the chimp genome paper, again) shows that the rate of indel differences is about one-fifth the single-base difference, rather than one-tenth. This improves our knowledge of the indel mutation rate, but there is nothing problematic about the improved estimate. So where's the problem?

Since your arguement is simply something about nested hierarchy then it's just another unsupported claim.

Why? Is this illustration not accurate in some way?

These ERVs seem to fall into a nested hierarchy just like the pseudogenes. You didn’t show me that my claim is not accurate. You only referenced a bunch of homologous ERVs that happened after the human-chimp split. It still doesn’t change the evidence I presented. You don’t think it at all odd that this nested hierarchy is now echoed in two separate lines of evidence? What alternative explanation do you have for this?

All I can figure is this is some homology arguement that identical sequences at identical locations are proof of common ancestry.

Identical sequences at identical locations are EVIDENCE for common ancestry. You still have yet to offer a better explanation. What else can it be evidence for?

You would have to assume that every ERV is the result of a germline invasion, something that has never been questioned. It only makes sense, unless you are fond of double standard that the differences are an proof against common ancestry.

No, you only have to assume that every ERV is an independent and singular event, which they are. Transposition also occurs randomly, therefore shared transposons are best explained by a single event that is passed on through common ancestry.

Take a look at ERV class 1:

(Initial sequence of the chimpanzee genome and comparison with the human genome

Note the differences in the Class 1 ERVs.

The accompanying claim is that the large difference in ERV class 1 for humans and chimps is indicative of failure of the independent nested hierarchy given by ERVs. That is simply false; from the diagram the bulk of ERV class 1s in chimpanzees is given by PtERVs 1 and 2, which are recent germline invasions or horizontal transfers from other species ( http://biology.plosjournals.org/perl...l.pbio.0030110 ). Not only does this mean that we do not expect them to be found in human lineages, but that their recentness means that they will be very active and heavily replicating and transposing all over the genome - which is precisely what the large difference is.

This is nothing less than mishandling of the data, a proper understanding of PtERV 1 and 2 shows that it simply isn't the disproof of ERV phylogeny mark has been vainly seeking for so long.

The caption for the figure clearly states that these are lineage specific insertions, and therefore not at orthologous positions. And in the case of PtERV-1 and 2, these are not even ERV's found in the human lineage. Again, the evidence for common ancestry is orthologous ERV's and transposons.

That is itself a classic example of an arguement from personal incredulity since you just said that you just, "claimed that a premise is true only because it has not been proven false, or that a premise is false only because it has not been proven true."

The existence of differences isn’t in dispute. Without differences between humans and chimps we wouldn’t be separate species. Therefore, we both accept that premise as truth.

What you have done is argue that you personally can not believe that human and chimps shared a common ancestor because there are too many differences for you accept the premise that they happened in the time since the split. This is an argument from personal incredulity.

http://en.wikipedia.org/wiki/Argument_from_ignorance

The argument from personal incredulity, also known as argument from personal belief or argument from personal conviction, refers to an assertion that because one personally finds a premise unlikely or unbelievable, the premise can be assumed not to be true, or alternately that another preferred but unproven premise is true instead.

You reject the premise that these differences happened since the human-chimp split without offering me evidence that supports the conclusion that they can’t. The only thing you have argued so far is that you personally find it unlikely or unbelievable.

 

[AnEmpiricalAgnostic]

You seem to be lacking in any support for this assertion. Tell me the class, location and sequence identity of these orthologous ervs. In short, identify the ERVs and lets do an actual comparison because I never argued that a lot of the DNA was the same. What would have had to happen is that mutations would have had to change what is different in the two genomes. Now stop argueing in circles around semantics and lets get to the actual evidence.

The paper you listed actually gives the chromosomal position and designation for each ERV. You already have this information.

First of all, I don't accept the assumption that all of these ERVs are the result of germline invasions. Last time I checked germline invasions were rare. Now you want me to accept without qualification that close to half of the human genome is the result of them. Your whole arguement rests on that one single assumption and it has never been qualified.

Most of our genome is non-coding DNA to begin with, so I am not sure what the problem is. And yes, half of our DNA is probably processed transposons, retroelements, and ERV's. So what? ERV's are easily distinguished, as are recently inserted LTR's (30 million years or more recent are easily distinguished from background "Junk DNA").

This is what I found on the homologous retroviruses, where is the location of the orthologous ones?

Check out Table 1 and tell me why exactly this is not a group of ERVs that are suitable for comparison. The time of insertion predates the common acestor and if you are going to be particular about the ones we compare then identify, characterize and locate them.

This paper outlines recombination in HERV-K LTR's. That is, the sequence comparisons of each LTR does not fall into nested hierarchy because the LTR's recombined with one another which masks previous mutations. These events are detectable, which is what the paper is all about. Also, HERV-K tends to insert in areas of repeats in the host genome which makes them susceptible to recombination events. The abstract says that "The high frequency of these events casts doubt on the accuracy of integration time estimates based only on divergence between retroelement LTRs." This says nothing about their original integration which can be used.
The "ectopic recombination" paper can also be found in html format here. Table 1 lists the ERV's used in the comparisons, the location in the human genome, and the most distant species in which the ERV is found. They used PCR to test for the ERV in other species by using primers in the flanking DNA of the integration site.

First of all you are throwing TOE around like it actually means something to you. Define evolution, because I know what the word means and it defines the burden of proof for a primate common ancestor. Stop argueing in circles and apply some meaning to the words you are using.

A change in the frequency of alleles in a population from one generation to the next, including the emergence of new species. In this debate I have offered three separate lines of evidence supporting the idea that modern primates are emergent species from a common ancestral population. You have yet to offer a better conclusion given the evidence I have presented.

…you haven't provided a lick of evidence.

This is simply untrue. You have failed to address the evidence from what I assume to be a lack of understanding. Simply stating that it’s not there isn’t going to make it go away any more than stating your disbelief in the amount of human-chimp differences will. You need to give me a better explanation for the evidence than common ancestry. As it stands now there is none.

You have yet to examine any of the carefully research evidence I am presenting…

I did examine it. You offered some information on irrelevant homologous ERVs, incorrectly characterized pseudogenes…

pseudogenes are not, in general, transposons. The chart Mark linked to includes processed pseudogenes as transposons. This is a very particular type of pseudogene. It's generated when a gene is transcribed and then processed (introns removed, poly-A tail added), and the RNA transcript is read back into DNA by reverse transcriptase that happens to be hanging about. The DNA can be reinserted at a new spot in the genome just like an ERV. GULOP is not a processed pseudogene.

and made arguments from personal incredulity about how you can’t believe that the amount of mutations happened since the human-chimp split and how mutations gave us such a big brain. If I missed something let me know.

So far, all that you have demonstrated is an unwaivering confidence in the reliablity of Talk Origins and Loudmouth.

Again, I have provided three separate lines of evidence. Each of these lines of evidence supports the conclusion of common ancestry of primates (including humans). You have not offered a better explanation and you haven’t show the evidence to be faulty in any way. As I said in the beginning, I am deferring to Loudmouth and sfs to assist in debunking your assertions as they are a microbiologist and geneticist respectively. I knew it would be easy for you to make misleading claims about these esoteric subjects that would be difficult, if not impossible, for a nonscientist like myself to debunk. Is there something untrue about the information they have given me?

No, I am comparing the human brain to the ape brain which is comparative anatomy.

For the express purpose of stating “This is what they are telling us was the result of mutational forces that shaped our species” suggesting that you personally find it unlikely or difficult to believe. Does that sound familiar? It’s because it’s another argument from personal incredulity.

I am also making inferances from comparitive genomics based on the observed mutation rate, which is genetics.

It may fall under the subject of genetics but fails to show how the differences are impossible. Again, you personally find it unlikely or difficult to believe that the mutations happened since the human-ape split but you don’t give reason to believe that it is not possible.

Did I mention that the single common ancestor model has absolutly nothing to do with evolution as science.

Common ancestry is part of the science of evolution because it pertains to the emergence of new species. Evolution doesn’t postulate that new species are magically created every now and then. They emerge from a common ancestor, isolation, mutation, selection, and time.

"What possible explanation could there be?" That is nothing but an arguement from incredulity you are making while accusing me of it.

No. It’s a request for an alternative explanation for the evidence I have presented other than common ancestry. Since you do not accept common ancestry as the best explanation for the evidence I have presented I am asking you for an alternative.

I have offered three independent lines of evidence that are only explained by the validity of the common ancestry and you have only tried to obfuscate the debate and change the subject by offering elaborate arguments from personal incredulity. In the hopes that your dismissal of the evidence at hand was from a lack of understanding I have tried to be clearer in my argument.

On the table is the GULO Pseudogene that is broken in the same way as other primates and forms a nested hierarchy when aligned, ERVs that we also share with other primates that again form a nested hierarchy, and human chromosome 2 which apparently formed as a fusion of two other primate chromosomes.

I ask one again, please, address this evidence. Either explain how the evidence is faulty or give me another explanation for it. Asserting it’s not there isn’t making it go away.

 

[mark kennedy]

I’m afraid you still don’t fully understand the implications of the GULO pseudogene I’m presenting as positive evidence of the TofE and common ancestry.

I understand it just fine, I just don't accept your conclusion since it's an assumption to begin with. I don't know what is so hard about this, GULO is a disfuntional gene. There is even reason to believe that it actually works in certain populations of Eskimos. These ERVs are showing up in psuedogenes a lot and I am starting to see how a person could make the connection between mutations in them and common ancestry. The problem is that the ERVs and mutations need not presuppose a common ancestor. What we can be sure of is the the GULO gene is disfuntional because selective pressure isn't acting on it because it's not vital.

PAY CLOSE ATTENTION TO THIS PARAGRAPH! An inspection of the gene shows that modern primates have the gene broken in the same way. THIS IS IMPORTANT. This is where something should strike you as funny. Why would these different primates have the gene broken in the same way? If they all had working copies of the gene at the start, then developed pseudogenes separately they should be broken differently (like the guinea pig). This is not what we see though. They are the same. Unless you posit that each of these organisms was created with identically broken pseudogenes then the only other explanation could be common ancestry. They all inherited it from the same population of organisms with a broken GULO gene.

Allright, I'll tell you what. I would be willing to give you this point under one condition. If we are talking about the same disfuntion in the same loci then the inverse logic has to be valid. If we are looking at unique traits fixed with specific loci then 'special creation' logically follows. I'm not saying you have to accept my conclusion, only that you recognize the logic and concede that it is valid and reasonable. Now back to your regularly scheduled arguement:

Once again a closer inspection of the pseudogene reveals a nested hierarchy. Human-old world monkey differences are greater than the human-gorilla differences which are again greater than the human-chimp difference. I illustrated this by the multi-colored arrow pointing at the primate pseudogenes. What kind of sense does this make from the standpoint of common design? The only way it makes any sense at all is through common ancestry.

Just bear one thing in mind before we jump to conclusions. Just because natural selection does not act on one mutation does not mean that their will not be pressure in another part of the gene. To be honest, I'm far from convinced that the gene is completely disfuntional.

The first thing to take notice of it how each pseudogene is broken. They each have a deletion in an identical location. They are all broken the same way. Why would we find something like this is common ancestry is false?

It could be that the gene breaks at the same point because it is weak at the same point. This next part is interesting, I want to take another look at it.

Now really look at the alignment between human, chimp, orang, and macaque pseudogenes. You’ll see Human-macacaque differences are greater than the human-orang differences which are again greater than the human-chimp difference. Here are the breakdowns of the GULO/P (Exon10) for each animal in my argument

Not a bad explanation and a pretty persuasive image. I haven't actually looked at the gene and direct comparisons between chimpanzees, humans, chickens...et al. Before I do I just wanted to ask you a simple question, if the commonality of certain identical breaks in the chain speak strongly for common ancestry then do unique features make a strong point for independant lineage? Mind you I'm not talking relative independance but 'special creation', as a rational explanation and a viable alternative.

I hope this clarifies my pseudogene argument. Once again I ask you to either show me how this evidence is flawed or to provide me with a better explanation for the evidence.

The evidence, while mildly persuasive and well illustrated is anecdotal. What I am finding is that there are a number of psuedo genes that diverge, sometimes they are broken in the same place and sometimes they are just plain different. For me the protein coding and regulatory genes are paramount particularly when they are highly conserved. If I break a plate glass window you could get one of the guys from CSI to put it together in a pattern. When you have a completely unbroken pane the differences can only be account for by design. Don't worry, we will get back to that one.

But they are all the same. You keep missing that point. If they were created as separate lineages then, like the guinea pig, the gene would be broken in a unique way. Since they are all broken the same way then you would have to cling to the absurd notion that they were created with the same broken genes from the start or accept common ancestry. If you don’t understand this by now please go back and reexamine the top of this post until it sinks in. I don’t know how to make my argument clearer at this point.

Not really, what I am saying is that a lot of genes are made the same way and break in the same way. It's when they actually have to do something that commonality and divergence become crucial.

Common ancestry is the only reasonable explanation for the evidence at hand. I challenge you to provide another.

That is, as I said before, an arguement from incredulity. You are importing far to much from your evidence and making too broad a conclusion from it.

I’ll use a quote from sfs on the matter since he’s the geneticist:

I'm well aware of what sfs says about indels, mostly they are too variable to know about the rate. Frankly, I don't think that the indels were dealt with at all in the paper and he is giving me some insights into why not. I just found it odd that this buisness of the DNA being 98% the same is still being propagated when we know better.

Why? Is this illustration not accurate in some way?

I wouldn't characterize it as inaccurate, I would call it anecdotal. Your begging the question of proof here on your hands and knees. I'm still amazed that you can be such a die hard skeptic about God's role in creation but accept that 8% of the genome is made of fragmented viruses without qualification.

I have the figure in the original paper, it kind of tracts the ERV as it gets larger in succeding lineages. This is a '98% DNA is the same' line of arguement all over again. For decades we hear that we are 98% chimpanzee and it fits the mutation rate perfectly. Then we find out that it's 95% and it still fits the mutation rate perfectly or we don't know enough about indels. Our time would be better spent dealing with what we do know then speculating about what we don't because what we don't know is a lot.

These ERVs seem to fall into a nested hierarchy just like the pseudogenes. You didn’t show me that my claim is not accurate. You only referenced a bunch of homologous ERVs that happened after the human-chimp split. It still doesn’t change the evidence I presented. You don’t think it at all odd that this nested hierarchy is now echoed in two separate lines of evidence? What alternative explanation do you have for this?

These ERVs do not fall in you nested hiearchy if they are in different places so lets not talk about how the vast majority of ERVs are characterized. Most of these ERV sites end up taking you to psuedogenes. It makes sense for the ERVs to be in the same location if they are vulnerable to germline invasions at the same site. I have seen absolutly nothing making common ancestry the only explanation and don't expect to.

Identical sequences at identical locations are EVIDENCE for common ancestry. You still have yet to offer a better explanation. What else can it be evidence for?

Yes it is, and differences in functionally biased genes related to neural functions are evidence as well. I'll match my highly conserved neural genes against your disfunctional ERVs and psuedogenes any day.

The existence of differences isn’t in dispute. Without differences between humans and chimps we wouldn’t be separate species. Therefore, we both accept that premise as truth.

Ohhhh, now I get it, you only want to look at the things that are exactly the same. You don't want to go to the trouble of having to actually come up with a genetic mechanism for adaptation.

What you have done is argue that you personally can not believe that human and chimps shared a common ancestor because there are too many differences for you accept the premise that they happened in the time since the split. This is an argument from personal incredulity.

All you have argued is that there is a single nucleotide missing in chickens, rats, humans...et al. It doesn't prove anything about evolution of anything other then possibly viruses. Nevermind that the expansion of the human brain is a giant leap of nature, it must have happened because only God is the alternative. You want me to look at your anecdotal evidence and come to the same conclusion you did. I can't come to that conclusion because I did not make your a priori assumption before actually looking at the evidence.

You reject the premise that these differences happened since the human-chimp split without offering me evidence that supports the conclusion that they can’t. The only thing you have argued so far is that you personally find it unlikely or unbelievable.

I don't recall any probablity arguements in my responses to your postitive proofs. Your the one who keeps spouting 'prove it's impossible' while accusing me of arguments from incredulity. When it comes to ERVs or any of the Transposable Elements I'm not really sure what is possible and what is not. The bottom line here is neither is anyone else. I don't care if you draw the conclusion of common ancestry based on anecdotal evidence and mutations in psuedogenes. What is more I have no intentions of trying to talk you out of it.

Evolution is about the change of alleles in populations over time. You are still not telling me how the untolled number of alleles involved in the expansion of the human brain from apes is caused by identifiable genetic mechanisms. Genetics researchers commonly confess that they don't know exactly what it is but a died in the wool evolutionist can't do that. They have to exaggerate every simularity and dismiss the most crucial question regarding human origins, what is the genetic basis of the 3 fold expansion of the human brain from that of apes?

[Note: I have a strict personal rule against double posting in formal debates. Unfortunatly I neglected to inform my opponent of this fact. It was implied in the rules of debate but apparently not explictly enough. I will be happy to discuss any part or all of it, particularly the evidence, presented elsewhere or in later responses. However, I refuse to respond to them here. I apologize for not making this clear in the invitation but one post per round is all that I will submit.]

 

[AnEmpiricalAgnostic]

I don't know what is so hard about this, GULO is a disfuntional gene. There is even reason to believe that it actually works in certain populations of Eskimos.

I would be very interested to see this. Unless I’m missing something, finding a working GULO in any modern human would undermine my entire pseudogene argument as evidence for common ancestry. In fact, I think that would be a major problem for common ancestry altogether.

The problem is that the ERVs and mutations need not presuppose a common ancestor. What we can be sure of is the the GULO gene is disfuntional because selective pressure isn't acting on it because it's not vital.

I’m not arguing that the evidence I’m presenting leaves no other alternative but common ancestry. I will argue that, given the evidence I’ve presented, alternative explanations become much less reasonable. For example, your alternative explanation for identically broken GULOPs in the primates I’ve presented is:

”It could be that the gene breaks at the same point because it is weak at the same point.”

While I’m not sure what would constitute a “weak” point that would cause a specific nucleotide to be so highly susceptible to deletion that it would happen in separate organisms simultaneously, I do understand that it is a far less reasonable explanation than common ancestry.

Additionally, taking a step back and considering the guinea pig as well as the other mammals that have a working GULO gene seems to take away that hypothesis because they show no sign of the proposed weak point.

I do like that you’re thinking about it now though. You’re glimpsing into the minds of the scientists that work in this field. You have done a good job coming up with what is probably the second best explanation for the evidence but close examination shows it to be inferior to common ancestry. While common ancestry may not be the only explanation for the evidence it is the best and more reasonable one. This is the only reason it is provisionally accepted as truth.

Allright, I'll tell you what. I would be willing to give you this point under one condition.

While I’ll maintain that the honest thing to do would be to concede points on their own merit unconditionally, I like that you’re willing to entertain different ideas and promise to listen to your ideas with an open mind.

If we are talking about the same disfuntion in the same loci then the inverse logic has to be valid. If we are looking at unique traits fixed with specific loci then 'special creation' logically follows. I'm not saying you have to accept my conclusion, only that you recognize the logic and concede that it is valid and reasonable.

If I’m understanding correctly, if we find different genetic sequences in identical locations for organisms that are supposed to share a recent common ancestor (like humans and chimps) then it would suggest special creation.

I would say that the strength of that argument would depend on how different the sequences were. For example, if the genes shared between humans and chimps at the same location had differences that produced different sized brains then that would be a fairly weak argument (although I understand the logic). If you were to find two organisms that were supposed to share a recent common ancestor that shared genes in the same locations where one produced a tail and the other produced an eye then it would be a problem for common ancestry.

Just bear one thing in mind before we jump to conclusions. Just because natural selection does not act on one mutation does not mean that their will not be pressure in another part of the gene. To be honest, I'm far from convinced that the gene is completely disfuntional.

I’m not sure how you could think otherwise. Looking at the working rat GULO gene and then looking at the various primate GULOPs shows that while they are all very similar the rat’s gene makes vitamin c while the one in primates doesn’t.

Not a bad explanation and a pretty persuasive image. I haven't actually looked at the gene and direct comparisons between chimpanzees, humans, chickens...et al. Before I do I just wanted to ask you a simple question, if the commonality of certain identical breaks in the chain speak strongly for common ancestry then do unique features make a strong point for independant lineage? Mind you I'm not talking relative independance but 'special creation', as a rational explanation and a viable alternative.

I understand your logic but I think that as you search for your unique features you’ll start running into nested hierarchies again. If common ancestry is correct then you’ll find the least unique features where two organisms share recent ancestors and the most unique features where they share distant ancestors. If you can find the opposite to be true you’ll have an argument against common ancestry.

What I am finding is that there are a number of psuedo genes that diverge, sometimes they are broken in the same place and sometimes they are just plain different.

If you look closely at the organisms to which they belong you will find that the ones that have them broken in the same place (such as primates) will be proposed to share recent common ancestors while the ones that are different (like the guinea pig) will not.

All you have argued is that there is a single nucleotide missing in chickens, rats, humans...et al.

No, no, no. You sill don’t understand it fully. The rat has a working copy. Only the primates are missing the single nucleotide. ONLY THE PRIMATES. The guinea pig has a GULOP that is broken differently than the primates. Go back and look more closely. Not only do the primates share this distinctive deletion but a close look at the gene, nucleotide by nucleotide, reinforces the nested hierarchy. Understand now?

Ohhhh, now I get it, you only want to look at the things that are exactly the same.

No, the differences are important too. The differences and similarities are all part of the big picture and both need to be taken into account.

As time goes by organisms in separate species acquire more and more of these differences. As the differences accumulate genetic divergence becomes greater and greater. When we really start to look at the gene sequences we don’t see these differences being the same between each species. Some species have a lot more similarities than others. We both seem to agree on this much.

Here I have evidence that takes a really close look at the similarities and finds that there are pieces of genetic code shared between species that is broken (same way and same location). The part that you keep missing is that different species have identical breakage. I don’t have to posit common ancestry to see this. Common ancestry is the conclusion that seeing this leads me to. If each separate species had the code broken in different ways then I could see your point. If there are humans with the gene currently working then it would effectively refute my argument altogether.

You have made a decent effort in explaining this by positing some kind of weak point in the gene but close examination of other organisms that have the gene don’t show this weak point. This means that even if there was a weak point it’s only shared by these primates. This in itself would be evidence of common ancestry.

Once you see that these primates acquired these identically broken genes from a common ancestral population then you will also make sense of the differences within the genes. If all the different species were specially created then the differences between these genes would be the same. This is not what we see though. Humans and chimps are the most similar, followed by orangs, followed my macaques. This is that pesky nested hierarchy that keeps rearing its head. It all makes perfect sense when positing common ancestry as the reason. This is why I accept it as provisionally true (not because I have anything against the idea that a deity created life).

Just so you understand where I’m coming from; My dismissal of a deity creating all the species without common ancestry is simply because the idea doesn’t hold up to the evidence at hand. To me it’s like dismissing the need for a deity to pull the sun across the sky. There are now better natural explanations for both. Neither is an argument that your deity doesn’t exist. It simply means it wasn’t responsible for creating the species without evolution and common ancestry.

 

[mark kennedy]

The modern mystics who imagine life emerging from the Darwinian warm little pond are nothing new under the sun. Mythographers have been attributing to primordial elementals what is rightfully attributed to God since the dawn of time:

The Mesopotamian mythographers took their inspiration from thier own country...When nothing yet had a name, that is to say when nothing had yet been created, they wrote, Apsu (the fresh waters) Tiamat (the salt waters) and Mummu (the clouds) formed together one single confused body:

"When on high the heaven had not been named, Firm ground below had not been called by name, Naught but primordial Apsu, their begetter, and Mummu and Tiamat she who born them all. No reed hut had been matted, no marsh land had appeared, when no gods whatever had been brought into being. Uncalled by name their destinies undetermined. Then it was that the gods were formed withing them." (Ancient Iraq, Georges Roux)​

The elemental muse was greater in pagan myths then the gods, they in fact gave rise to them. These naturalistic mechanisms are the creator in the mind of the mythographers of ancient and modern times.

I would be very interested to see this. Unless I’m missing something, finding a working GULO in any modern human would undermine my entire pseudogene argument as evidence for common ancestry.

I don't know why you put so much importance on the disfuntional gene but it may well work in Eskimos:

In a discussion of whether Eskimos are obligatory carnivores, as are cats, Sinclair (1981) stated: 'It is also possible that Eskimos, like other carnivores, have not lost the enzyme that makes ascorbic acid and therefore do not need dietary sources.'​

HYPOASCORBEMIA

In fact, I think that would be a major problem for common ancestry altogether.I’m not arguing that the evidence I’m presenting leaves no other alternative but common ancestry.

Why do evolutionists insist on painting themselves into this corner? Most other mammals possess the enzyme L-gulonolactone oxidase. The Eskimos on the other hand survive on a diet of 90% meat and unless they are producing vitiman C from this gene their survival in the artic is inexplicable. This is a disfuntional gene, nothing more. Selective pressure on this gene could deliever this gene repairable to a functional status. This is in fact the only reasonable explanation for the presense of the gene in the first place, it served a purpose in the originally created kinds and simply feel into disuse over time. The conclusion of universal common ancestry begs the question of proof from this gene on it's hands and knees.

Common ancestry is not an explanation, it's ad hoc conjecture based on anecdotal evidence. Jumping to conclusions with both feet does not produce the mental and physical tools of science. It conflates the evidence and buries it in a modern mysiticism that assumes exclusivly naturalistic causes like the pagan mystics of ancient times.

Unlike many of the evolutionists I have encountered over the last couple of years, you seem honest at least. I think you really are seeing things exactly as you describe them and I'm trying to understand why. Perhaps because that is the only truth you trust and God as an explanation simply isn't an option, I don't know.

If I’m understanding correctly, if we find different genetic sequences in identical locations for organisms that are supposed to share a recent common ancestor (like humans and chimps) then it would suggest special creation.

If we are looking at a gene that is identical in two species both closely and distantly related to other species with the exact same gene with the exact same mutation in the exact same place. That is a pretty compelling argument for common ancestry. In this case I don't think you have anything like that since it works in most mammals and probably is either function on some human populations or repairable in some way. The human being is unique amoung living systems and diverges from the chimpanzee right down to the sequences of the DNA. For years geneticists have been claiming that we are 99% identical to apes in our DNA.

Cover Story: What Makes us Different? Not very much, when you look at our DNA. But those few tiny changes made all the difference in the world

They claim we are 98% the same as chimpanzees in our DNA and they know that this is not true. Why would they lie? Because the mutation rate for hominids does not account for the divergence between chimpanzees and humans. Nature did the exact same thing when announcing the Chimpanzee Genome. They claimed that in our DNA we are 98% the same as chimpanzees and they know this is not true. Type 'chimpanzee genome' into you google search engine and you will find this at the top:

What makes us human? We share more than 98% of our DNA and almost all of our genes with our closest living relative, the chimpanzee. .​

Nature Web Focus: The chimpanzee genome

The study they are announcing clearly indicates that the two geneome diverge by at least 100,000,000 more base pairs then Time or Nature are telling you. If you are wondering why creationists don't accept what mainstream science, it's not because we are incredulous. It's because we are tired of being lied to and then talked to as if you are stupid for not believing it. They lie to us and call it science.

You sill don’t understand it fully. The rat has a working copy. Only the primates are missing the single nucleotide. ONLY THE PRIMATES. The guinea pig has a GULOP that is broken differently than the primates. Go back and look more closely. Not only do the primates share this distinctive deletion but a close look at the gene, nucleotide by nucleotide, reinforces the nested hierarchy. Understand now?

I understand perfectly, I understood it the first time. I understand you are putting importance on this disfunctional gene that doesn't prove anything one way or the other.

Let's cut to the chase, brian size and complexity is the prize. What common ancestry has to have is a genetic mechanism for overhauling the neural genes of apes, which results in the brain tripling in size. Comparisons of genes involved in neural functions are turning up some pretty compelling arguements for special creation.

You will find that every human trait from head to toe, literally, is unique in many or most respects. When the DNA was thought to be 99% it was no problem reconciling the mutation rate to divergence between chimpanzees and humans. Now it's impossible. This is a classic example, this is how the mutation rate has been reconciled to 98% of the DNA being the same:

Total divergence

For starters, we should be able to predict how different the genomes should be. The seven million years of evolution in each lineage represents about 350,000 generations in each (assuming 20 years per generation). How many mutations happen per generation? Estimating mutation rates is not easy (at least without assuming common descent): it is hard to find a few changed nucleotides out of 3 billion that have not changed. By studying new cases of genetic diseases, individuals whose parents' do not have the disease, however, it is possible to identify and count new mutations, at least in a small number of genes. Using this technique, it has been estimated[1] that the single-base substitution rate for humans is approximately 1.7 x 10^-8 substitutions/nucleotide/generation, that is, 17 changes per billion nucleotides. That translates into ~100 new mutations for every human birth. (17 x 3, for the 3 billion nucleotides in the genome, x 2 for the two genome copies we each carry). At that rate, in 350,000 generations a copy of the human genome should have accumulated about 18 million mutations, while the chimpanzee genome should have accumulated a similar number.

The evolutionary prediction, then, is that there should be roughly 36 million single-base differences between humans and chimpanzees.​

Common ancestry of humans and chimpanzees: mutations by sfs

What Time, Nature and this little essay have completly ignored is that the diverence is not 32 Mb, it's upwards of 145 Mb and even the mutation rate for active viruses could not account for that level of divergence:

"By contrast, HERV-K18, RTVL-Ha, and RTVL-Hb are found only in humans, chimpanzees, and gorillas, which are thought to have diverged around 5 million years ago. To estimate the age of each provirus the human/chimpanzee distances from each tree were used to calibrate the rate of molecular evolution at each locus. The most recent common ancestor of humans and chimpanzees lived approximately 4.5 mya, so divedin the distance between the huyman and chimpanzee siquences (substitutions per site) by this numbner gives rates ranging from 2.3 to 5.0 x 10^-9 substitutions per site per year. These numbers are simular to the estimated rates of evolution for pseudogenes and noncoding regions of mammalian genes.​

(PNAS Constructing primate phylogenies from ancient retrovirus sequences, 2006)

Put simply, at the upper end of retrovirus reproduction the substitutions per years are 5 per 1 billion base pairs. For the common ancestor starting 7 million years ago (not the 4.5 mya used in the PNAS paper) it would require no less then 20 base pairs per year and all of them would have to be permentantly fixed in the respective genomes. That is why Time and Nature lied, that is why now evolutionists are trying to make a base pair mean either one base pair or a million. The truth does not line up with the evidence so it's just not working.

As time goes by organisms in separate species acquire more and more of these differences. As the differences accumulate genetic divergence becomes greater and greater. When we really start to look at the gene sequences we don’t see these differences being the same between each species. Some species have a lot more similarities than others. We both seem to agree on this much.

We can agree that seperate species are marked by differences in the DNA sequences. If they are related by common ancestry the DNA will be virtually identical except for genes purged during bottlenecks. Gene flow is severly diminished at these times and evolution becomes a one way trip. Once the divergence is fixed from the originally created kind to potential for diversification begins to diminish.

Here I have evidence that takes a really close look at the similarities and finds that there are pieces of genetic code shared between species that is broken (same way and same location). The part that you keep missing is that different species have identical breakage. I don’t have to posit common ancestry to see this. Common ancestry is the conclusion that seeing this leads me to. If each separate species had the code broken in different ways then I could see your point. If there are humans with the gene currently working then it would effectively refute my argument altogether.

What refutes your arguement is not the simularities but the enourmous amount of divergence in such a brief period of geological time. In 2 1/2 million years the brain tripled in size, in fact, it started to grow 2 mya and was very close to modern proportions 1.6 mya. This does not happen in nature but if you line up the ape fossils next to the human ones it gives the illusion that it did. Your argument is refuted on the most conserved genes and tissue in the human body had to undergo an intense overhaul that has no know mechanism for creating or preserving them. Even the Chimpanzee Genome Consortium said that natural selection was not a factor in human evolution. They instead attributed it to regional variations of mutation rates. The mutation rates of viruses do not account for the level of divergence and they allude to regional variations. How much divergence could possibly have been gained by changing geological region?

You have made a decent effort in explaining this by positing some kind of weak point in the gene but close examination of other organisms that have the gene don’t show this weak point. This means that even if there was a weak point it’s only shared by these primates. This in itself would be evidence of common ancestry.

No I didn't, I conceded that identical breaks in identical genes are compelling evidence for common ancestry. I suggest other possibilities and offered the real basis for human evolution if it did indeed happen. It would have had to be in the neural genes.

Once you see that these primates acquired these identically broken genes from a common ancestral population then you will also make sense of the differences within the genes. If all the different species were specially created then the differences between these genes would be the same. This is not what we see though. Humans and chimps are the most similar, followed by orangs, followed my macaques. This is that pesky nested hierarchy that keeps rearing its head. It all makes perfect sense when positing common ancestry as the reason. This is why I accept it as provisionally true (not because I have anything against the idea that a deity created life).

The neural genes and the overall divergence is standing nested hiearchies on their heads. Apes are very simular, Old world monkeys are very simular, New world monkeys are very simular. Human neural genes are unique across the board.

Just so you understand where I’m coming from; My dismissal of a deity creating all the species without common ancestry is simply because the idea doesn’t hold up to the evidence at hand. To me it’s like dismissing the need for a deity to pull the sun across the sky. There are now better natural explanations for both. Neither is an argument that your deity doesn’t exist. It simply means it wasn’t responsible for creating the species without evolution and common ancestry.

It means you differ to primordial elementals what I attribute to God. I am certain that we have exausted the evidence for psuedo genes or at least argued it to a standstill. The ERVs have no rational basis for the contention that 8% of the human genome is the result of germline invasions so that will do absolutly nothing one way or the other.

 

[mark kennedy]

The modern mystics who imagine life emerging from the Darwinian warm little pond are nothing new under the sun. Mythographers have been attributing to primordial elementals what is rightfully attributed to God since the dawn of time:

The Mesopotamian mythographers took their inspiration from thier own country...When nothing yet had a name, that is to say when nothing had yet been created, they wrote, Apsu (the fresh waters) Tiamat (the salt waters) and Mummu (the clouds) formed together one single confused body:

"When on high the heaven had not been named, Firm ground below had not been called by name, Naught but primordial Apsu, their begetter, and Mummu and Tiamat she who born them all. No reed hut had been matted, no marsh land had appeared, when no gods whatever had been brought into being. Uncalled by name their destinies undetermined. Then it was that the gods were formed within them." (Ancient Iraq, Georges Roux)​

The elemental muse was greater in pagan myths then the gods, they in fact gave rise to them. These naturalistic mechanisms are the creator in the mind of the mythographers of ancient and modern times.

I would be very interested to see this. Unless I’m missing something, finding a working GULO in any modern human would undermine my entire pseudogene argument as evidence for common ancestry.

I don't know why you put so much importance on the disfuntional gene but it may well work in Eskimos:

In a discussion of whether Eskimos are obligatory carnivores, as are cats, Sinclair (1981) stated: 'It is also possible that Eskimos, like other carnivores, have not lost the enzyme that makes ascorbic acid and therefore do not need dietary sources.'​

HYPOASCORBEMIA

In fact, I think that would be a major problem for common ancestry altogether.I’m not arguing that the evidence I’m presenting leaves no other alternative but common ancestry.

Why do evolutionists insist on painting themselves into this corner? Most other mammals possess the enzyme L-gulonolactone oxidase. The Eskimos on the other hand survive on a diet of 90% meat and unless they are producing vitiman C from this gene their survival in the artic is inexplicable. This is a disfuntional gene, nothing more. Selective pressure on this gene could deliever this gene repairable to a functional status. This is in fact the only reasonable explanation for the presense of the gene in the first place, it served a purpose in the originally created kinds and simply feel into disuse over time. The conclusion of universal common ancestry begs the question of proof from this gene on it's hands and knees.

Common ancestry is not an explanation, it's ad hoc conjecture based on anecdotal evidence. Jumping to conclusions with both feet does not produce the mental and physical tools of science. It conflates the evidence and buries it in a modern mysiticism that assumes exclusivly naturalistic causes like the pagan mystics of ancient times.

Unlike many of the evolutionists I have encountered over the last couple of years, you seem honest at least. I think you really are seeing things exactly as you describe them and I'm trying to understand why. Perhaps because that is the only truth you trust and God as an explanation simply isn't an option, I don't know.

If I’m understanding correctly, if we find different genetic sequences in identical locations for organisms that are supposed to share a recent common ancestor (like humans and chimps) then it would suggest special creation.

If we are looking at a gene that is identical in two species both closely and distantly related to other species with the exact same gene with the exact same mutation in the exact same place. That is a pretty compelling argument for common ancestry. In this case I don't think you have anything like that since it works in most mammals and probably is either function on some human populations or repairable in some way. The human being is unique amoung living systems and diverges from the chimpanzee right down to the sequences of the DNA. For years geneticists have been claiming that we are 99% identical to apes in our DNA.

Cover Story: What Makes us Different? Not very much, when you look at our DNA. But those few tiny changes made all the difference in the world

They claim we are 98% the same as chimpanzees in our DNA and they know that this is not true. Why would they lie? Because the mutation rate for hominids does not account for the divergence between chimpanzees and humans. Nature did the exact same thing when announcing the Chimpanzee Genome. They claimed that in our DNA we are 98% the same as chimpanzees and they know this is not true. Type 'chimpanzee genome' into you google search engine and you will find this at the top:

What makes us human? We share more than 98% of our DNA and almost all of our genes with our closest living relative, the chimpanzee. .​

Nature Web Focus: The chimpanzee genome

The study they are announcing clearly indicates that the two geneome diverge by at least 100,000,000 more base pairs then Time or Nature are telling you. If you are wondering why creationists don't accept what mainstream science, it's not because we are incredulous. It's because we are tired of being lied to and then talked to as if you are stupid for not believing it. They lie to us and call it science.

You sill don’t understand it fully. The rat has a working copy. Only the primates are missing the single nucleotide. ONLY THE PRIMATES. The guinea pig has a GULOP that is broken differently than the primates. Go back and look more closely. Not only do the primates share this distinctive deletion but a close look at the gene, nucleotide by nucleotide, reinforces the nested hierarchy. Understand now?

I understand perfectly, I understood it the first time. I understand you are putting importance on this disfunctional gene that doesn't prove anything one way or the other.

Let's cut to the chase, brian size and complexity is the prize. What common ancestry has to have is a genetic mechanism for overhauling the neural genes of apes, which results in the brain tripling in size. Comparisons of genes involved in neural functions are turning up some pretty compelling arguements for special creation.

You will find that every human trait from head to toe, literally, is unique in many or most respects. When the DNA was thought to be 99% it was no problem reconciling the mutation rate to divergence between chimpanzees and humans. Now it's impossible. This is a classic example, this is how the mutation rate has been reconciled to 98% of the DNA being the same:

Total divergence

For starters, we should be able to predict how different the genomes should be. The seven million years of evolution in each lineage represents about 350,000 generations in each (assuming 20 years per generation). How many mutations happen per generation? Estimating mutation rates is not easy (at least without assuming common descent): it is hard to find a few changed nucleotides out of 3 billion that have not changed. By studying new cases of genetic diseases, individuals whose parents' do not have the disease, however, it is possible to identify and count new mutations, at least in a small number of genes. Using this technique, it has been estimated[1] that the single-base substitution rate for humans is approximately 1.7 x 10^-8 substitutions/nucleotide/generation, that is, 17 changes per billion nucleotides. That translates into ~100 new mutations for every human birth. (17 x 3, for the 3 billion nucleotides in the genome, x 2 for the two genome copies we each carry). At that rate, in 350,000 generations a copy of the human genome should have accumulated about 18 million mutations, while the chimpanzee genome should have accumulated a similar number.

The evolutionary prediction, then, is that there should be roughly 36 million single-base differences between humans and chimpanzees.​

Common ancestry of humans and chimpanzees: mutations by sfs

What Time, Nature and this little essay have completly ignored is that the diverence is not 32 Mb, it's upwards of 145 Mb and even the mutation rate for active viruses could not account for that level of divergence:

"By contrast, HERV-K18, RTVL-Ha, and RTVL-Hb are found only in humans, chimpanzees, and gorillas, which are thought to have diverged around 5 million years ago. To estimate the age of each provirus the human/chimpanzee distances from each tree were used to calibrate the rate of molecular evolution at each locus. The most recent common ancestor of humans and chimpanzees lived approximately 4.5 mya, so divedin the distance between the huyman and chimpanzee siquences (substitutions per site) by this numbner gives rates ranging from 2.3 to 5.0 x 10^-9 substitutions per site per year. These numbers are simular to the estimated rates of evolution for pseudogenes and noncoding regions of mammalian genes.​

(PNAS Constructing primate phylogenies from ancient retrovirus sequences, 2006)

Put simply, at the upper end of retrovirus reproduction the substitutions per years are 5 per 1 billion base pairs. For the common ancestor starting 7 million years ago (not the 4.5 mya used in the PNAS paper) it would require no less then 20 base pairs per year and all of them would have to be permentantly fixed in the respective genomes. That is why Time and Nature lied, that is why now evolutionists are trying to make a base pair mean either one base pair or a million. The truth does not line up with the evidence so it's just not working.

As time goes by organisms in separate species acquire more and more of these differences. As the differences accumulate genetic divergence becomes greater and greater. When we really start to look at the gene sequences we don’t see these differences being the same between each species. Some species have a lot more similarities than others. We both seem to agree on this much.

We can agree that seperate species are marked by differences in the DNA sequences. If they are related by common ancestry the DNA will be virtually identical except for genes purged during bottlenecks. Gene flow is severly diminished at these times and evolution becomes a one way trip. Once the divergence is fixed from the originally created kind to potential for diversification begins to diminish.

Here I have evidence that takes a really close look at the similarities and finds that there are pieces of genetic code shared between species that is broken (same way and same location). The part that you keep missing is that different species have identical breakage. I don’t have to posit common ancestry to see this. Common ancestry is the conclusion that seeing this leads me to. If each separate species had the code broken in different ways then I could see your point. If there are humans with the gene currently working then it would effectively refute my argument altogether.

What refutes your arguement is not the simularities but the enourmous amount of divergence in such a brief period of geological time. In 2 1/2 million years the brain tripled in size, in fact, it started to grow 2 mya and was very close to modern proportions 1.6 mya. This does not happen in nature but if you line up the ape fossils next to the human ones it gives the illusion that it did. Your argument is refuted on the most conserved genes and tissue in the human body had to undergo an intense overhaul that has no know mechanism for creating or preserving them. Even the Chimpanzee Genome Consortium said that natural selection was not a factor in human evolution. They instead attributed it to regional variations of mutation rates. The mutation rates of viruses do not account for the level of divergence and they allude to regional variations. How much divergence could possibly have been gained by changing geological region?

You have made a decent effort in explaining this by positing some kind of weak point in the gene but close examination of other organisms that have the gene don’t show this weak point. This means that even if there was a weak point it’s only shared by these primates. This in itself would be evidence of common ancestry.

No I didn't, I conceded that identical breaks in identical genes are compelling evidence for common ancestry. I suggest other possibilities and offered the real basis for human evolution if it did indeed happen. It would have had to be in the neural genes.

Once you see that these primates acquired these identically broken genes from a common ancestral population then you will also make sense of the differences within the genes. If all the different species were specially created then the differences between these genes would be the same. This is not what we see though. Humans and chimps are the most similar, followed by orangs, followed my macaques. This is that pesky nested hierarchy that keeps rearing its head. It all makes perfect sense when positing common ancestry as the reason. This is why I accept it as provisionally true (not because I have anything against the idea that a deity created life).

The neural genes and the overall divergence is standing nested hiearchies on their heads. Apes are very simular, Old world monkeys are very simular, New world monkeys are very simular. Human neural genes are unique across the board.

Just so you understand where I’m coming from; My dismissal of a deity creating all the species without common ancestry is simply because the idea doesn’t hold up to the evidence at hand. To me it’s like dismissing the need for a deity to pull the sun across the sky. There are now better natural explanations for both. Neither is an argument that your deity doesn’t exist. It simply means it wasn’t responsible for creating the species without evolution and common ancestry.

It means you differ to primordial elementals what I attribute to God. I am certain that we have exausted the evidence for psuedo genes or at least argued it to a standstill. The ERVs have no rational basis for the contention that 8% of the human genome is the result of germline invasions so that will do absolutly nothing one way or the other.

 

[AnEmpiricalAgnostic]

I don't know why you put so much importance on the disfuntional gene but it may well work in Eskimos:

The Eskimos on the other hand survive on a diet of 90% meat and unless they are producing vitiman C from this gene their survival in the artic is inexplicable.

In 1928 the arctic anthropologist and adventurer Vilhjalmur Stefansson attempted to prove his theory of how Eskimo (Inuit) people are able to avoid scurvy with almost no plant food in their diet. This had long been a puzzle because the disease had struck European Arctic explorers living on similar high-meat diets. Stefansson theorised that the native peoples of the Arctic got their vitamin C from fresh meat that was raw or minimally cooked. Starting in February 1928, for one year he and a colleague lived on an animal-flesh-only diet under medical supervision at New York's Bellevue Hospital; they remained healthy.​

http://en.wikipedia.org/wiki/Vitamin_C​

The Inuit have the same GULOP as all other humans. The animals they feed on have working GULO genes however. They just get their vitamin-c from the animals they hunt and eat.

Why do evolutionists insist on painting themselves into this corner? Most other mammals possess the enzyme L-gulonolactone oxidase.

You’re still missing the point and I’m starting to wonder if you simply being disingenuous. While most other mammals have a working copy of this gene primates do not. Look at the sequences I posted. Primates all share a tell tale deletion in the same place. How did that shared deletion get there if these primates didn’t get it from a common ancestor Mark? Can you answer that?

This is a disfuntional gene, nothing more.

No Mark. It’s much, much more. It’s important because it’s broken in an identical manner among primates. You dodging that explicit fact isn’t making it go away.

Selective pressure on this gene could deliever this gene repairable to a functional status.

No it can’t. There are no working copies of that gene to select.

This is in fact the only reasonable explanation for the presense of the gene in the first place, it served a purpose in the originally created kinds and simply feel into disuse over time.

This is not a reasonable explanation because primates all share the exact same dysfunction. If they fell into disuse independently then, like the guinea pig, it would be broken differently among primates. This is not what we find. Please stop ignoring this simple explicit fact and address the evidence at hand.

Unlike many of the evolutionists I have encountered over the last couple of years, you seem honest at least. I think you really are seeing things exactly as you describe them and I'm trying to understand why. Perhaps because that is the only truth you trust and God as an explanation simply isn't an option, I don't know.

It’s the only truth that makes sense given the evidence at hand. I have nothing against your god. If it fit the evidence then I would have absolutely no beef with belief in special creation. This simply isn’t the case though.

If we are looking at a gene that is identical in two species both closely and distantly related to other species with the exact same gene with the exact same mutation in the exact same place. That is a pretty compelling argument for common ancestry.

WELCOME TO MY GULOP PSEUDOGENE ARGUMENT! Look at the breakdown for Exon10 between humans and chimps. They are not only identical genes but they share an identical deletion that makes then dysfunctional. Now look at humans, chimps, and macaques. Although the macaque sequence is more different than humans and chimps they still share the identical deletion. This is what I’ve been showing you all along!

In this case I don't think you have anything like that since it works in most mammals and probably is either function on some human populations or repairable in some way.

This is EXACTLY what I have. The fact that it works in most mammals isn’t terribly important to the argument because either all mammals inherited it from a common ancestor or were all specially created with working copies. What is central to this argument is that the primates (yes, including humans) all have this same gene that is broken in an identical manner. How did all these primates get this exact same deletion in the exact same place if they were independently created?

I know you are smart enough to understand my arguments as I’m sure anyone reading this debate has figured out also. While I haven’t done a great job explaining ERVs I know that the pseudogene argument and the fused gene are presented clearly enough for anyone to understand. You’re being disingenuous in order to evade addressing the evidence and it’s pretty obvious at this point.

While you blubber about science lying to you about how they come up with their figures and try to cling to mathematical discrepancies based on obscure estimates as justification for your incredulity you completely ignore the perfectly straight forward and easy to understand evidence right in front of you. If you ask me, that is dishonest.

As the icing on the cake, conflating evolution with other creation myths of antiquity and this whole paranoid “science is lying to us” conspiracy angle is damaging your argument more than anything else. No matter how much you try and obfuscate this debate with that rhetoric the simple fact remains that you haven’t addressed the simple, straight forward, easy to understand evidence I’ve presented.

In the end only evolution has the answer to these questions. Only common ancestry explains the evidence at hand. If you had another viable explanation, even if it was less likely, I would respect your belief. But all that you have given me is evasion and incredulity. I have no other option to dismiss special creation as the vestigial relic of antiquated beliefs and not the viable alternative to evolution you propose it to be.

Thank you for the invitation to debate you Mark. This has been an invaluable experience to me and I appreciate finally being able to have a serious discussion with a creationist. Also, thank you to the others that helped me in the more esoteric aspects of this debate. Unless anyone feels that there is anything left to discuss I believe this debate has run its course and leave it to the readers to draw their own conclusions.

 

[mark kennedy]

The Inuit have the same GULOP as all other humans. The animals they feed on have working GULO genes however. They just get their vitamin-c from the animals they hunt and eat.

They did this experiement in 1928 and in 1981 OMIN still cites a peer reviewed scientific paper suggesting Inuits might still retain the ability to produce this enzyme. I'm not entirely sure where the image presented earlier in the thread showing a single mutation in the exact same place in the exact same squence but it's bogus:

"Humans and other primates have no functional gene for L-gulono-gamma-lactone oxidase that catalyzes the last step of L-ascorbic acid biosynthesis. The 164-nucleotide sequence of exon X of the gene was compared among human, chimpanzee, orangutan, and macaque, and it was found that nucleotide substitutions had occurred at random throughout the sequence with a single nucleotide deletion, indicating that the primate L-gulono-gamma-lactone oxidase genes are a typical example of pseudogene."

Random nucleotide substitutions in primate nonfunctional gene for L-gulono-gamma-lactone oxidase, the missing enzyme in L-ascorbic acid biosynthesis.​

You’re still missing the point and I’m starting to wonder if you simply being disingenuous. While most other mammals have a working copy of this gene primates do not. Look at the sequences I posted. Primates all share a tell tale deletion in the same place. How did that shared deletion get there if these primates didn’t get it from a common ancestor Mark? Can you answer that?

I allready have, the 164 nucleotide sequence is not identical except for the one nucleotide shown in you figure. The deletion appears at random in various lineages because there is no selective pressure to prevent the deletion. The primates that have this disfunctional gene do get their vitiman C from other sources but that does not mean the gene cannot function, just that it currently doesn't.

It’s important because it’s broken in an identical manner among primates. You dodging that explicit fact isn’t making it go away.

No it's not and I've been looking at psuedo gene comparisons on Gene browsers and they rarely line up between primates.

This is not a reasonable explanation because primates all share the exact same dysfunction. If they fell into disuse independently then, like the guinea pig, it would be broken differently among primates. This is not what we find. Please stop ignoring this simple explicit fact and address the evidence at hand.

You show me a picture of a single nucleotide deleted in the same sequence in different species. You claims the only explanation if common ancestry but there are mutations throughout the dysfunctional gene:

"Sequence analysis study indicated that the human L-gulono-gamma-lactone oxidase gene has accumulated a large number of mutations since it stopped being active and that it now exists as a pseudogene in the human genome."

It’s the only truth that makes sense given the evidence at hand. I have nothing against your god. If it fit the evidence then I would have absolutely no beef with belief in special creation. This simply isn’t the case though.

This has nothing to do with God or common descent, it's nothing but begging the question of evidence. Psuedo genes are mutated at random, chimpanzee and human psuedo genes are not identical except for a single deletion, it's just not true.

WELCOME TO MY GULOP PSEUDOGENE ARGUMENT! Look at the breakdown for Exon10 between humans and chimps. They are not only identical genes but they share an identical deletion that makes then dysfunctional. Now look at humans, chimps, and macaques. Although the macaque sequence is more different than humans and chimps they still share the identical deletion. This is what I’ve been showing you all along!

I don't mind so much that you focused on anecdotal evidence but did you have to pick the easiest one to refute?

This is EXACTLY what I have. The fact that it works in most mammals isn’t terribly important to the argument because either all mammals inherited it from a common ancestor or were all specially created with working copies. What is central to this argument is that the primates (yes, including humans) all have this same gene that is broken in an identical manner. How did all these primates get this exact same deletion in the exact same place if they were independently created?

You will be amazed at how very different these psuedo genes are when you do side by side comparisons. It's more then one single nucleotide deletion and they are not identical.

I know you are smart enough to understand my arguments as I’m sure anyone reading this debate has figured out also. While I haven’t done a great job explaining ERVs I know that the pseudogene argument and the fused gene are presented clearly enough for anyone to understand. You’re being disingenuous in order to evade addressing the evidence and it’s pretty obvious at this point.

I'm not trying to evade anything, I spent most of my time tracking down the comparisons of ERVs in the genome browsers. Then you get fixated on this psuedo gene that you don't even accuratly characterize and misinform everyone, myself included, that the only deletion is a single nucleotide. Now as far as the fused gene I can can only assume you mean the Chromosome 2a 2b fusion. Like I said early in the debate, there are 9 pericentric inversions covering 20 Mb across the genome. Some of them were 2 Mb to 4 Mb long. All of these sequences flip flop all over the place with no deleterious effects. No one know why but because theres a ttagg sequence in chromosome 2 it must all be true. It's anecdotal at it's finest.

While you blubber about science lying to you about how they come up with their figures and try to cling to mathematical discrepancies based on obscure estimates as justification for your incredulity you completely ignore the perfectly straight forward and easy to understand evidence right in front of you. If you ask me, that is dishonest.

Time said the chimpanzee and human DNA was 98% identical, they lied it is 95%, a difference of 100 million base pairs. Nature magazine did the same thing along with a couple of scientists I am aquainted with. They lie about the evidence, what it is saying and what it all means. I know they are lieing because I follow their work with great interest and catch them lying all too often.

Frankly I have proven everything I said in this thread and calling me dishonest with Time and Natures lies exposed should be telling people something. The announcement in Nature's web focus page says 98% and the article they are announcing says 95%. That's a difference of 100 million base pairs but you have no problem with that. Now if I catch them lying then you want to call me dishonest, this should be telling people something.

As the icing on the cake, conflating evolution with other creation myths of antiquity and this whole paranoid “science is lying to us” conspiracy angle is damaging your argument more than anything else. No matter how much you try and obfuscate this debate with that rhetoric the simple fact remains that you haven’t addressed the simple, straight forward, easy to understand evidence I’ve presented.

I understand the arguments and refuted it on the evidence. I never said that science is lying to us and that is the kind of disingenuise rethoric that conflates the issues in the first place. I am a student of pagan mysticism and they all extol the power of the elementals above those of any of the pagan gods. You will find this holds true in Chinese naturalistic mysticism, the kaballa and evolution as primordial history.

The myth I quoted was not a creation story, it was attributing to elementals that which is rightly attributed to God. It is identical to the modern mythology of evolutionary molecules to man fantasies.

In the end only evolution has the answer to these questions. Only common ancestry explains the evidence at hand. If you had another viable explanation, even if it was less likely, I would respect your belief. But all that you have given me is evasion and incredulity. I have no other option to dismiss special creation as the vestigial relic of antiquated beliefs and not the viable alternative to evolution you propose it to be.

Thank you for the invitation to debate you Mark. This has been an invaluable experience to me and I appreciate finally being able to have a serious discussion with a creationist. Also, thank you to the others that helped me in the more esoteric aspects of this debate. Unless anyone feels that there is anything left to discuss I believe this debate has run its course and leave it to the readers to draw their own conclusions.

One of the things that any scientific inquiry into inheritable traits has to examine in Mendelian genetics. Darwinian tree of life graphs prove nothing except that modern mystics are obsessed with assuming common ancestry all the way back to primordial soup. Real science does not do that, the genuine article of science does not pit ones religion against empirical evidence. Actual science is about tools, mental and physical. It is your to build as you see fit whether it be a religiously oriented view of the life sciences or nillistic atheistic mythologies.

"IN crossing a health, suppose I pitched my foot against a stone, and were asked how the stone came to be there; I might possibly answer, that, for any thing I knew to the contrary, it had lain there for ever: nor would it perhaps be very easy to show the absurdity of this answer. But suppose I had found a watch upon the ground, and it should be inquired how the watch happened to be in that place; I should hardly think of the answer which I had before given, that, for any thing I knew, the watch might have always been there. Yet why should not this answer serve for the watch as well as for the stone? why is it not as admissible in the second case, as in the first? ("Evidences of the existence and attributes of the Deity. Collected from the appearances of nature 12th edition. (William Paley, D.D. Later Archdeacon of Carlisle)
​

Among the icons (idols) of modern mysticism there is one that reigns supreme. It is the myth of evolution. We scoff at the gods of the ancient pagans as if we were untouched by their superstition and yet we mystify our science with the likes of Darwin, the high priest of natural selection. Darwin taught a fable that started in a warm little pond and through a process that has became known as gradualism (minute changes over eons) all life arose out of a primordial soup. I found that this mythographer was doing what the mystics back in ancient Babylon had done, they attributed to primordial elementals what is rightfull attributed to God.

For the genuine article of science that identifies boundries beyond which one species cannot change into an altogether different kind, see my signiture. Science doesn't need this Single Common Ancestor Mythology, it's distorting the evidence and being used to undermine religious convinction on a macro scale.

Thanks for the debate, it's allways fun having this out without being tag teamed by ten of you.

 

[suzybeezy]

Debate Complete - closing thread