-
Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.
-
CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.
Does it bother creationists when...
- Thread starter 46AND2
- Start date
Smidlee
Veteran
According to Darwin it has to proven that it's not possible for something to evolved. You have to prove a negative in order to falsify evolution.
I wrote "something like mad cow disease". What happen they operated on someone who had the disease and didn't know it. They use the same equipment to operate many others before they realize the first patient had the disease. From what I heard you can't sterilize the instruments . You have to throw them away after operating someone with the disease since proteins are so small they can hide in the grooves of the medal. It was really sad to see a mother who had two children (after having back surgery) realize it's just a matter of time before she will have symptoms of the disease.
Last edited:
Upvote
0
All you need to do is show us multiple and obvious violations of the twin nested hierarchy for complex life. Why don't we see any of these species or fossils?
It is ID supporters who are claiming that IC systems can not evolve. They are the ones who hvae pinned their hopes on proving a negative. Why can't they support their own claims?
Upvote
0
PsychoSarah
Chaotic Neutral
Sounds like, maybe polio? But if it happened recently I doubt that, prion diseases (caused by warped proteins) aren't usually contracted that way nor do they manifest themselves very quickly most of the time.
Upvote
0
If you cannot back up a story with links then all you have is a story. It seems no one is accepting this story of yours. It may be true, it may not. I don't see how it supports ID either way.
And you seem to keep forgetting that the published claims of specific systems being irreducibly complex have been debunked.
Upvote
0
The idea of more or less information, loss or gain of information has been brought up many times by creatsionists and IDers
The problem is none have been able to come with an operational definition for measuring information. Without that, we have no way of determining the amount of information involved so no one can say there is a gain or loss, more or less.
So to back up your statement about producing large amounts of information, you need to tell us how to measure it. So far no creationist or IDer has done so but who knows, maybe you can.
Dizredux
Upvote
0
Smidlee
Veteran
While it's true we haven't been able yet to get an exact measurement of all the information in a cell (a lot more codes need to be cracked) what we do know is enough to give us a good idea.
http://vimeo.com/81930637
Upvote
0
That is exactly what they are trying to do. Their entire argument is, "No evolution, therefore ID".
And yet they can't measure it in any meaningful manner, and still have not supported their claim that evolution can not produce it.
There you go trying to prove a negative again.
Upvote
0
You don't even have a methodology for measuring what ID supporters call "information". If you think I am wrong, tell us how you measure information in this DNA sequence:
TGGGGCCCATGGTTGAATGACTCCTATAACGGACTTCGACATGGCAAAATCCCCCC
CTTGCAACTTCTAGAGGAGAAGAGTACTGACTTGAGCGCTCCCAGCACAACGGCCA
AGGAAGTCTCCAATTTCTTGTTTCCGAATGACACGCGTCTCCTTGCGGGTAAATCGC
CGACCGCAGAACTTAGGAGCCAGGGGGAACA
Upvote
0
This is incorrect. There are many potential ways of falsifying evolution. Here are a just few examples.
Find rabbit in the cambrian or a cow in the devonian.
Show a genetic barrier that limits the extent of evolutionary change in a population.
Show that offspring are genetically identical to the parents.
Show that mutations are not possible.
Show that the genome cannot change in populations over time.
Show that if there are mutations, they cause no change in the phenotype.
These are just a few ways of falsifying evolution and there are plenty of others.
The problem is that none of these have been found. People have been trying to falsify evolution for over 150 years and it has passed every attempt so far. That does not mean that something will not come tomorrow that could put doubt on the theory or falsify it all together but that does not look like the way to bet.
So the statement that
has been falsified.
Dizredux
Upvote
0
Smidlee
Veteran
What does 10001000111100110010001000111110010101001001 mean? Who knows. The data that contain the code for the movie is totally useless without the DVD player and a TV to watch the movie on. To accurately measure the exact amount of "meaningful" information from Shannon's information on a DVD you need a DVD player to discover the function of the information. Yet even without a DVD player we can get some idea of how much information is written on it.
********************************
this is a incorrect as scientist would pointed out one misplaced fossil would not falsify the ToE. Not only have scientist found misplaced fossils but older layers of rock on top of younger rock.
This has already been discovered but evolutionist believe dGRN were more flexible in the past than today.
so on and so on.
Last edited:
Upvote
0
So you can't measure information in a DNA sequence.
This scientist can measure Shannon information, and he found that evolution increases information.
Nucleic Acids Res. Jul 15, 2000; 28(14): 27942799.
Evolution of biological information
Thomas D. Schneider
ABSTRACT
How do genetic systems gain information by evolutionary processes? Answering this question precisely requires a robust, quantitative measure of information. Fortunately, 50 years ago Claude Shannon defined information as a decrease in the uncertainty of a receiver. For molecular systems, uncertainty is closely related to entropy and hence has clear connections to the Second Law of Thermodynamics. These aspects of information theory have allowed the development of a straightforward and practical method of measuring information in genetic control systems. Here this method is used to observe information gain in the binding sites for an artificial protein in a computer simulation of evolution. The simulation begins with zero information and, as in naturally occurring genetic systems, the information measured in the fully evolved binding sites is close to that needed to locate the sites in the genome. The transition is rapid, demonstrating that information gain can occur by punctuated equilibrium.
Evolution of biological information
Evolution of biological information
Thomas D. Schneider
ABSTRACT
How do genetic systems gain information by evolutionary processes? Answering this question precisely requires a robust, quantitative measure of information. Fortunately, 50 years ago Claude Shannon defined information as a decrease in the uncertainty of a receiver. For molecular systems, uncertainty is closely related to entropy and hence has clear connections to the Second Law of Thermodynamics. These aspects of information theory have allowed the development of a straightforward and practical method of measuring information in genetic control systems. Here this method is used to observe information gain in the binding sites for an artificial protein in a computer simulation of evolution. The simulation begins with zero information and, as in naturally occurring genetic systems, the information measured in the fully evolved binding sites is close to that needed to locate the sites in the genome. The transition is rapid, demonstrating that information gain can occur by punctuated equilibrium.
Evolution of biological information
As you have already conceded, random mutations can refine promoters which involve Shannon information where the transmitter and receiver are the promoter and transcription regulators.
Upvote
0
Since ID/creationists, and even you, are claiming that evolution can not produce new information, this would mean that you cracked the code. So let's see it.
Upvote
0
Smidlee
Veteran
I never claimed evolution which it nothing but "trial and error" can't produce (refine) new information. Trial and error is old as dirt but it's a brutal way to find an answer. We know enough about the genetic code that it's more complex than anything Bill Gates has created.
Upvote
0
I am not going to watch a video over an hour long, that is not a reasonable request. Can you tell me in your own words how information is measured say genetic areas.
So far no one has done it yet.
Dizredux
Upvote
0
Posted by Dizreduxt
Diz
On another point, you bring up Shannon Information. You do realize that this has to do with signal processing and not biology or genetics?
Smidlee, you seem to be a pretty intelligent guy so I was hoping you could come up with some new stuff. Alas it appears that it is not to be.
In disappointment,
Dizredux
Posted by Smidlee
To the degree I am talking about, I doubt it. A good try at avoiding the the point though.
This is something geologists have been aware of for a long and pretty much know the dynamics involved. It has been explained so many times that it is now considered a PRATT (Points refuted a thousand times). Did you really think this was evidence of anything or that geologists were not aware of the phenomena or how it came about?
Diz
Smidlee
"Been discovered". Oh wow! a potential Nobel awaits. Forgive my cynicism but I would like to see something on this from a science based source.
On another point, you bring up Shannon Information. You do realize that this has to do with signal processing and not biology or genetics?
Smidlee, you seem to be a pretty intelligent guy so I was hoping you could come up with some new stuff. Alas it appears that it is not to be.
In disappointment,
Dizredux
Upvote
0
Similar threads
