• Starting today August 7th, 2024, in order to post in the Married Couples, Courting Couples, or Singles forums, you will not be allowed to post if you have your Marital status designated as private. Announcements will be made in the respective forums as well but please note that if yours is currently listed as Private, you will need to submit a ticket in the Support Area to have yours changed.

  • CF has always been a site that welcomes people from different backgrounds and beliefs to participate in discussion and even debate. That is the nature of its ministry. In view of recent events emotions are running very high. We need to remind people of some basic principles in debating on this site. We need to be civil when we express differences in opinion. No personal attacks. Avoid you, your statements. Don't characterize an entire political party with comparisons to Fascism or Communism or other extreme movements that committed atrocities. CF is not the place for broad brush or blanket statements about groups and political parties. Put the broad brushes and blankets away when you come to CF, better yet, put them in the incinerator. Debate had no place for them. We need to remember that people that commit acts of violence represent themselves or a small extreme faction.

DNA Stability

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
It may take some time for me to pose my question in proper biological terms, so bear with me as I stumble my way through the terms.

As I understand it, everyone's DNA is unique - like a fingerprint. At the same time, all human DNA is the same. The way I process that in my mechanical engineer's mind is a model with variables. So, for example, the human eye is modelled in DNA, and that model has a variable specifying eye color. So, all human models of the eye (the DNA for the eye) is the same, but the variables (eye color) are different.

The first question would be: Is that a reasonable description?

If so, the second question would be about junk DNA. Is the junk DNA the same for all humans? IOW, it may not code. It may not have a known function. We may not know what the model and variables are or what they represent, but is all junk DNA the same per the above description?
 

Oncedeceived

Senior Veteran
Jul 11, 2003
21,214
629
✟66,870.00
Gender
Female
Faith
Christian
Marital Status
Married
It may take some time for me to pose my question in proper biological terms, so bear with me as I stumble my way through the terms.

As I understand it, everyone's DNA is unique - like a fingerprint. At the same time, all human DNA is the same. The way I process that in my mechanical engineer's mind is a model with variables. So, for example, the human eye is modelled in DNA, and that model has a variable specifying eye color. So, all human models of the eye (the DNA for the eye) is the same, but the variables (eye color) are different.

The first question would be: Is that a reasonable description?

If so, the second question would be about junk DNA. Is the junk DNA the same for all humans? IOW, it may not code. It may not have a known function. We may not know what the model and variables are or what they represent, but is all junk DNA the same per the above description?

You might want to add in this discussion the new finding of a second language in the code.

Scientists discover double meaning in genetic code | UW Today

One describes how proteins are made, and the other instructs the cell on how genes are controlled. One language is written on top of the other, which is why the second language remained hidden for so long.
 
Upvote 0

Papias

Listening to TW4
Dec 22, 2005
3,967
988
60
✟72,306.00
Faith
Catholic
Marital Status
Married
The experts on this forum (both Christian and unbeliever) can give the details, but their time is precious. So in appreciation of their kindness in helping out, how about if I cover some basics so they won't have to? (and I hope they'll correct any mistakes I make). : )

First, Human DNA is 99.9+ % the same from person to person. With a total of 3 GB (or 3 Billion "letters", each of which is either A T C or G), that still leaves a lot of room for variation. (0.001% of 3 GB is still 30,000 letters that are different - where I might have a "T", where you have an "A", etc.).

Of that 3 GB, only 2% or less is in genes (making up around 20,000 genes). For each gene, one can have different types, which can give different features. These different types are called "alleles". So for an eye color gene (located at a specific place, say, 30,000 letters down chromosome 11), one could have the blue allele or the brown allele - both of which help form the eye, but which give different results.

OK, so, what differences are there between people? Here are some of the main categories of differences.

1. The most obvious is different alleles for the same gene. So for a skin color gene, one allele could make the skin a bit darker, one could make the skin a bit lighter. Also, a mutation in a gene could be "silent" in that it has no effect on the gene function (due to the redundancy of the amino acids). The same goes for non-coding areas that have an effect, such as regulatory sections.
2. random mutational differences in noncoding (and non-used) DNA. These won't be expressed if they are in DNA that isn't affecting anything. These could be any of many different mutation types.
Here are some basic types of mutations and how they work:

  • 2A Duplication of a stretch of DNA. This is like accidentally copying part of a book twice. Example – when making a copy of a book that has chapters 1, 2, 3,4,5,6,7,8,9,10,11, 12, you end up with a book that has chapters 1, 2, 3,4,5,6,7,3,4,5,6,7,8,9,10,11, 12
  • 2B Deletion of a base pair. AATCTGTC becomes ATCTGTC
  • 2C Addition of base pair AATCTGTC becomes ACATCTGTC
  • 2D Transposition (like a mirror) AATCTGTC becomes CTGTCTAA


All of these can have no effect, an effect which is selected for, or an affect which is selected against.

I think all differences are going to fall into one of those categories. Notice that some differences used for "fingerprinting" are in "junk" (non-used) DNA. For instance, one common method is to count the number of repeated sections in areas that often have many repeats.

So person A, in location 3 might have: ATCGCGAGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGA (5 repeats)

So person B, in location 3 might have: ATCGCGAGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGTATGATCCGTCTGGA (8 repeats)

Now, if we look at 10 locations like this, we might find for person A:

location # repeats
3 5
6 4
8 11
22 3
24 9
25 19
26 28
32 12
35 6
36 19


while for person B, we might find :

location # repeats
3 17
6 22
8 19
22 20
24 15
25 8
26 12
32 22
35 11
36 7

See how that works to fingerprint a sample? Especially after looking at not just 10 locations, but, say, 100?

Hopefully that's a start for others with more expertise to build upon.

In Christ-

Papias
 
Last edited:
Upvote 0

AirPo

with a Touch of Grey
Oct 31, 2003
26,363
7,214
62
✟184,357.00
Gender
Male
Faith
Atheist
Marital Status
Married
It may take some time for me to pose my question in proper biological terms, so bear with me as I stumble my way through the terms.

As I understand it, everyone's DNA is unique - like a fingerprint. At the same time, all human DNA is the same. The way I process that in my mechanical engineer's mind is a model with variables. So, for example, the human eye is modelled in DNA, and that model has a variable specifying eye color. So, all human models of the eye (the DNA for the eye) is the same, but the variables (eye color) are different.

The first question would be: Is that a reasonable description?

If so, the second question would be about junk DNA. Is the junk DNA the same for all humans? IOW, it may not code. It may not have a known function. We may not know what the model and variables are or what they represent, but is all junk DNA the same per the above description?

I think that is a good analogy.

As far as junk DNA, I liken it to comments in code. They don't do anything in the actual program, but they may be of some benefit to the next guy who comes along to fix something.
 
Upvote 0

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
Thanks. I think what you said matches with the description I gave.

2. random mutational differences in noncoding (and non-used) DNA.

My interest pertains to the stability of the junk DNA, so this part is what I'm most interested in. As I understand it, there are 3 basic sets of DNA: the coding DNA, the non-coding DNA that still plays a role in one way or another (primarily a regulatory role it seems), and the DNA for which no role is known.

I'm asking about the 3rd set - the DNA which appears to have no role. And I suppose I'm asking how the stability compares to the other 2 sets. So, is junk DNA less stable than coding DNA? IOW, is the junk DNA more likely to change from parent to child than the coding DNA?

It seems you're saying yes, the junk DNA is less stable.
 
Upvote 0

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
I think that is a good analogy.

Cool. Thanks.

As far as junk DNA, I liken it to comments in code. They don't do anything in the actual program, but they may be of some benefit to the next guy who comes along to fix something.

Hmm. Interesting. Who would the "guy" be that intends to "fix something"?
 
Upvote 0

AirPo

with a Touch of Grey
Oct 31, 2003
26,363
7,214
62
✟184,357.00
Gender
Male
Faith
Atheist
Marital Status
Married
Cool. Thanks.



Hmm. Interesting. Who would the "guy" be that intends to "fix something"?

Well me. I go into old code, some of which is commented, some of which isn't. Some of the comments are helpful, some of them are junk. I'd like to think my comments are helpful, but I'm pretty sure that the next guy to come along is going to say this stuff is junk.

^_^^_^^_^
 
Upvote 0

Papias

Listening to TW4
Dec 22, 2005
3,967
988
60
✟72,306.00
Faith
Catholic
Marital Status
Married
Caner wrote:

My interest pertains to the stability of the junk DNA, so this part is what I'm most interested in. As I understand it, there are 3 basic sets of DNA: 1 the coding DNA, 2 the non-coding DNA that still plays a role in one way or another (primarily a regulatory role it seems), and 3 the DNA for which no role is known.

Sounds like a good way to divide it. (my blue numbers)


I'm asking about the 3rd set - the DNA which appears to have no role. And I suppose I'm asking how the stability compares to the other 2 sets. So, is junk DNA less stable than coding DNA? IOW, is the junk DNA more likely to change from parent to child than the coding DNA?

My understanding (waiting for expert confirmation or denial) is that the odds of DNA in any set changing is the same. This is the measured and well known background odds of a mutation. In sets 1 and 2, natural selection then amplifies or reduces (most often) those in the gene pool, making them appear to change less often.

So from 1 parent to 1 child all three are the same, but over generations, set 3 changes more.
 
Upvote 0

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
My understanding (waiting for expert confirmation or denial) is that the odds of DNA in any set changing is the same. This is the measured and well known background odds of a mutation. In sets 1 and 2, natural selection then amplifies or reduces (most often) those in the gene pool, making them appear to change less often.

So from 1 parent to 1 child all three are the same, but over generations, set 3 changes more.

OK. I understand opportunity for a change would be the same, but does DNA repair play a role at all?
 
Upvote 0

Papias

Listening to TW4
Dec 22, 2005
3,967
988
60
✟72,306.00
Faith
Catholic
Marital Status
Married
OK. I understand opportunity for a change would be the same, but does DNA repair play a role at all?

The molecular machinery has a number of repair mechanisms, which are used as part of the copying process. I was only counting mutations that made it past all of them.

So my understanding is that DNA repair (and hence mutations that make it past all of them) are just as likely in all three sets.

In Christ - Papias
 
Upvote 0

essentialsaltes

Fact-Based Lifeform
Oct 17, 2011
49,305
51,602
Los Angeles Area
✟1,147,993.00
Country
United States
Faith
Atheist
Marital Status
Legal Union (Other)
OK. I understand opportunity for a change would be the same, but does DNA repair play a role at all?

I think that variations in the DNA that does something is under more selective pressure, and deleterious mutations get weeded out. But in the DNA that doesn't do anything, mutations don't matter, so they are easily preserved. So we'd expect more variation in the 'junk'.

"Variations are found all throughout the genome, on every one of the 46 human chromosomes. But this variation is by no means distributed evenly: It's not as if there is one difference every 1,000 bases as regular as rain. Instead, some parts of the genome are "hot spots" of variability, with hundreds of possible variations of a sequence. Other parts of the genome, meanwhile, don't vary much at all between individuals—in scientific parlance, they are said to be "stable."

The majority of variations are found outside of genes, in the "extra" or "junk" DNA that does not affect a person's characteristics. Mutations in these parts of the genome are never harmful, so variations can accumulate without causing any problems. Genes, by contrast, tend to be stable because mutations that occur in genes are often harmful to an individual, and thus less likely to be passed on."
 
Upvote 0

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
I think that variations in the DNA that does something is under more selective pressure, and deleterious mutations get weeded out. But in the DNA that doesn't do anything, mutations don't matter, so they are easily preserved. So we'd expect more variation in the 'junk'.

That's basically the same answer Papias gave, but I'm specifically asking about events that occur prior to selection.

Given what I do as an engineer, I'm curious about some of the structural and dynamic aspects of DNA. I've found papers that have studied certain structural aspects (beads on a string) and certain vibratory aspects. To me that implies some variation in strength along the DNA chain that might determine a higher likelihood of defects in certain regions.

And, each time repair is required is an opportunity for a mistake.

[edit] Sorry, I thought I was done with this post but more thoughts keep coming to me.

There is a way of processing DNA to look for patterns called the "chaos game". I haven't quite wrapped my head around all the implications of the patterns it creates, but coding DNA produces definite patterns and random DNA doesn't. Again, to me that would imply one has a different structural makeup than the other.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
It may take some time for me to pose my question in proper biological terms, so bear with me as I stumble my way through the terms.

As I understand it, everyone's DNA is unique - like a fingerprint. At the same time, all human DNA is the same.

All human DNA has the same sugar-phosphate backbone and uses the same 4 nucleic bases. What differs between humans is the order of the bases along the sugar-phosphate backbone.

dsDNA.jpg


The blue pentagons are the ribose sugars, the highlighter yellow sections are the phosphates that connect the ribose sugars, and the green, orange, and yellow pieces are the nucleic bases. All DNA has that basic chemical structure.

The way I process that in my mechanical engineer's mind is a model with variables. So, for example, the human eye is modelled in DNA, and that model has a variable specifying eye color. So, all human models of the eye (the DNA for the eye) is the same, but the variables (eye color) are different.

Actually, fingerprints are a good analogy. If you want to use the eye, the small differences in iris ridges and valleys would be a good comparison.

If so, the second question would be about junk DNA. Is the junk DNA the same for all humans? IOW, it may not code. It may not have a known function. We may not know what the model and variables are or what they represent, but is all junk DNA the same per the above description?

If memory serves, junk DNA has more differences between humans because there is a lack of natural selection removing deleterious mutations. Hopefully, sfs will correct me if I have that wrong.

As it stands right now, only ~10% of the human genome shows signs of having function:

"Using a high resolution evolutionary approach to find sequence showing evolutionary signatures of functionality we estimate that a total of 8.2% (7.1–9.2%) of the human genome is presently functional, . . ."
PLOS Genetics: 8.2% of the Human Genome Is Constrained: Variation in Rates of Turnover across Functional Element Classes in the Human Lineage

If someone wants to argue that the other 90% is functional, then they need to explain why those stretches of DNA can be changed by mutations without affecting function. As of now, no one knows of a function in DNA that is impervious to mutations. Therefore, sections of DNA that are accumulating mutations at a rate consistent with neutral drift are considered to be without function as it relates to fitness.
 
Upvote 0

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
Actually, fingerprints are a good analogy.

...

If memory serves, junk DNA has more differences between humans because there is a lack of natural selection removing deleterious mutations. Hopefully, sfs will correct me if I have that wrong.

Thanks. That seems in line with what everyone else has said. So, posts #11 & #14 are the next steps in the conversation.
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Given what I do as an engineer, I'm curious about some of the structural and dynamic aspects of DNA. I've found papers that have studied certain structural aspects (beads on a string) and certain vibratory aspects. To me that implies some variation in strength along the DNA chain that might determine a higher likelihood of defects in certain regions.

The physical aspects of a DNA molecule can affect the mutation rate. For example, methylated cytosines (aka C) tend to mutate a lot more than other bases.

"In mammals, the Cs of most CpG base pairs are methylated and hypermutable, as methyl-C is spontaneously deaminated, producing a T:G mismatch. Consequently, methyl-CpGs have a mutation rate that is 10–50 times greater than Cs in the context of other bases, and CpGs that are not subject to selection are replaced by TpG/CpA and eliminated from the genome. "
http://www.nature.com/nrg/journal/v11/n7/full/nrg2820.html

CpG is short for cytosine-phosphate-guanine which indicates when you have a cytosine then a gunanine in the standard 5' to 3' direction (in the diagram in the previous post, the carbons in the ribose molecule are labelled 1' to 5'). Sections of DNA with higher than average CpG content will experience more mutations than sections with lower CpG content.


There is a way of processing DNA to look for patterns called the "chaos game". I haven't quite wrapped my head around all the implications of the patterns it creates, but coding DNA produces definite patterns and random DNA doesn't. Again, to me that would imply one has a different structural makeup than the other.

Natural selection is what produces patterns in functional DNA. Other molecules like ribosomes or RNA transcriptases prefer to bind to specific DNA sequences. Therefore, if transcription and translation of a stretch of DNA is beneficial then these DNA sequences will be preserved.
 
Upvote 0

Resha Caner

Expert Fool
Sep 16, 2010
9,171
1,398
✟170,600.00
Gender
Male
Faith
Lutheran
Marital Status
Married
CpG is short for cytosine-phosphate-guanine which indicates when you have a cytosine then a gunanine in the standard 5' to 3' direction (in the diagram in the previous post, the carbons in the ribose molecule are labelled 1' to 5'). Sections of DNA with higher than average CpG content will experience more mutations than sections with lower CpG content.

Thanks. Are there other mechanisms?

Is there any reason to think CpG is more or less concentrated in junk DNA? It doesn't seem there would be ... unless the repeats Papias mentioned would increase the amount.

Natural selection is what produces patterns in functional DNA. Other molecules like ribosomes or RNA transcriptases prefer to bind to specific DNA sequences. Therefore, if transcription and translation of a stretch of DNA is beneficial then these DNA sequences will be preserved.

I'm not sure if we're speaking of the same patterns. For those I'm speaking of, they have to exist before they can be selected. I guess there was an implicit question in that: How random is junk DNA compared to coding DNA?
 
Upvote 0

Loudmouth

Contributor
Aug 26, 2003
51,417
6,143
Visit site
✟98,025.00
Faith
Agnostic
Thanks. Are there other mechanisms?

Is there any reason to think CpG is more or less concentrated in junk DNA? It doesn't seem there would be ... unless the repeats Papias mentioned would increase the amount.

If memory serves, repeats in transposons and retroviral sequence tend to be AT rich.

I'm not sure if we're speaking of the same patterns. For those I'm speaking of, they have to exist before they can be selected. I guess there was an implicit question in that: How random is junk DNA compared to coding DNA?

Depends on the randomness you are looking for. To use an analogy, would you say that the lottery is random? Most people would say that it is random. However, the lottery drawing happens at the same time on specific days, and the ping pong balls are always within a specific number range. Those aspects of the lottery are not random.

Also, when we say that mutations are random, we mean that mutations are random with respect to fitness in the same way that a lottery is random with respect to the players. Mutations are NOT random with respect to environment, CG content, or other features. I'm not sure about eukaryotes, but in prokaryotes there are more mutations in actively transcribed DNA than in untranscribed DNA due to the more fragile nature of single stranded DNA caused by the RNA transcription.
 
Upvote 0